Stem-loop sequence hsa-mir-320a

AccessionMI0000542 (change log)
Previous IDshsa-mir-320
Symbol HGNC:MIR320A
DescriptionHomo sapiens miR-320a stem-loop
Gene family MIPF0000163; mir-320
Literature search

201 open access papers mention hsa-mir-320a
(1377 sentences)

Stem-loop
   -c   -ccuc         uu       c      g 
5'   ucc     cgccuucuc  cccgguu uucccg a
     |||     |||||||||  ||||||| ||||||  
3'   agg     gcgggagag  gggucga aagggc g
   gu   aaaaa         uu       a      u 
Get sequence
Deep sequencing
1706144 reads, 5.33e+03 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 22244966-22245037 [-]
antisense
OTTHUMT00000215038 ; SLC39A14-001; intron 1
OTTHUMT00000378015 ; SLC39A14-005; intron 1
OTTHUMT00000215040 ; SLC39A14-003; intron 1
OTTHUMT00000215039 ; SLC39A14-002; intron 1
OTTHUMT00000378016 ; SLC39A14-004; intron 1
OTTHUMT00000378017 ; SLC39A14-006; intron 2
ENST00000359741 ; SLC39A14-001; intron 1
ENST00000520644 ; SLC39A14-005; intron 1
ENST00000240095 ; SLC39A14-003; intron 1
ENST00000381237 ; SLC39A14-002; intron 1
ENST00000289952 ; SLC39A14-004; intron 1
ENST00000524285 ; SLC39A14-006; intron 2
Database links

Mature sequence hsa-miR-320a-5p

Accession MIMAT0037311
Sequence

10 - 

gccuucucuucccgguucuucc

 - 31

Get sequence
Deep sequencing1004 reads, 94 experiments
Evidence not experimental

Mature sequence hsa-miR-320a-3p

Accession MIMAT0000510
Previous IDshsa-miR-320
Sequence

42 - 

aaaagcuggguugagagggcga

 - 63

Get sequence
Deep sequencing1693285 reads, 159 experiments
Evidence experimental; cloned [1-4], Illumina [5]
Database links
Predicted targets

References

1
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5