Stem-loop sequence hsa-mir-320a

Accession

MI0000542

Previous IDs

hsa-mir-320

Symbol

HGNC:MIR320A

Description

Homo sapiens miR-320a stem-loop

Gene family

MIPF0000163; mir-320

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-320. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology mir-320 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms.

Stem-loop

      c   -ccuc         uu       c      g 
gcuucg ucc     cgccuucuc  cccgguu uucccg a
|||||| |||     |||||||||  ||||||| ||||||  
uggagu agg     gcgggagag  gggucga aagggc g
      -   aaaaa         uu       a      u 

Deep sequencing

550701 reads, 69 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh37.p5): chr8: 22102475-22102556 [-]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 407037;MIR320A
• HGNC: 31632;MIR320A

Mature sequence hsa-miR-320a

• Accession: MIMAT0000510
• Previous IDs: hsa-miR-320
• Sequence: 48 - aaaagcuggguugagagggcga - 69
• Deep sequencing: 548498 reads, 49 experiments
• Evidence: experimental; cloned [1-4], Solexa [5]
• Validated targets:
  • MIRECORDS:hsa-miR-320a
  • MIRTARBASE:hsa-miR-320a
  • TARBASE:hsa-miR-320a
• Predicted targets:
  • DIANA-MICROT:hsa-miR-320a
  • MICRORNA.ORG:hsa-miR-320a
  • MIRDB:hsa-miR-320a
  • RNA22-HSA:hsa-miR-320a
  • TARGETMINER:hsa-miR-320a
  • TARGETSCAN-VERT:hsa-miR-320a
  • PICTAR-VERT:hsa-miR-320

References

1. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).