Stem-loop sequence cbr-mir-252

AccessionMI0000539 (change log)
DescriptionCaenorhabditis briggsae miR-252 stem-loop
Gene family MIPF0000285; mir-252
Stem-loop
   a    -  ----        a       u  u  c c      -   c  cc 
5'  gguc uc    ucccaguu uaaguag ag gc g agguaa ccg uu  a
    |||| ||    |||||||| ||||||| || || | |||||| ||| ||   
3'  ccag ag    aggguuaa auucguc uc cg c uccauu ggu aa  g
   g    u  uuuu        g       u  -  u a      u   u  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrII: 8309576-8309674 [-]
intergenic
Database links

Mature sequence cbr-miR-252

Accession MIMAT0000507
Sequence

17 - 

uaaguaguagugccgcagguaac

 - 39

Get sequence
Evidence by similarity; MI0000328