Stem-loop sequence cbr-mir-80

AccessionMI0000518 (change log)
DescriptionCaenorhabditis briggsae miR-80 stem-loop
Gene family MIPF0000258; mir-80
Literature search

1 open access papers mention cbr-mir-80
(1 sentences)

Stem-loop
   u   -ca   -uu   c  a         --     u  a       -c  u 
5'  gga   cuc   ucg uc gcuuucgac  augau cu aacaaua  gc g
    |||   |||   ||| || |||||||||  ||||| || |||||||  ||  
3'  ccu   gag   agc ag cgaaaguug  uacua ga uuguugu  cg u
   a   aua   cuu   a  c         au     -  g       aa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 14440871-14440970 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-80
cbr-mir-238chrIII: 14445069-14445183 [-]
cbr-mir-80chrIII: 14440871-14440970 [-]
Database links

Mature sequence cbr-miR-80

Accession MIMAT0000487
Sequence

61 - 

ugagaucauuaguugaaagccga

 - 83

Get sequence
Evidence by similarity; MI0000051

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).