Stem-loop sequence cbr-mir-79

AccessionMI0000517 (change log)
DescriptionCaenorhabditis briggsae miR-79 stem-loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention cbr-mir-79
(1 sentences)

Stem-loop 
   a    --auu u    u          uc     aa    u   auu 
5'  gaac     c ccga cuuuggugau  agcuu  auga aga   c
    ||||     | |||| ||||||||||  |||||  |||| |||   a
3'  cuug     g ggcu gaaaccauug  ucgaa  uacu ucu   g
   g    accuu c    c          ga     -a    -   gca
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrI: 1849413-1849505 [+]
intergenic
Database links

Mature sequence cbr-miR-79

Accession MIMAT0000486
Sequence

57 -  

auaaagcuagguuaccaaagcu

 - 78

Get sequence
Evidence by similarity; MI0000050

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).