Stem-loop sequence cbr-mir-79

Accession MI0000517
Description Caenorhabditis briggsae miR-79 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a    --auu u    u          uc     aa    u   auu 
 gaac     c ccga cuuuggugau  agcuu  auga aga   c
 ||||     | |||| ||||||||||  |||||  |||| |||   a
 cuug     g ggcu gaaaccauug  ucgaa  uacu ucu   g
g    accuu c    c          ga     -a    -   gca 
Get sequence
Deep sequencing
59 reads, 1 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (WS200) Overlapping transcripts
chrI: 1376274-1376366 [+]
intergenic

Mature sequence cbr-miR-79

Accession MIMAT0000486
Sequence

57 - 

auaaagcuagguuaccaaagcu

 - 78

Get sequence
Deep sequencing 54 reads, 1 experiments
Evidence by similarity; MI0000050

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).