![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cbr-mir-79 |
|||||
Accession | MI0000517 (change log) | ||||
Description | Caenorhabditis briggsae miR-79 stem-loop | ||||
Gene family | MIPF0000014; mir-9 | ||||
Literature search |
1 open access papers mention cbr-mir-79 | ||||
Stem-loop |
a --auu u u uc aa u auu 5' gaac c ccga cuuuggugau agcuu auga aga c |||| | |||| |||||||||| ||||| |||| ||| a 3' cuug g ggcu gaaaccauug ucgaa uacu ucu g g accuu c c ga -a - gca |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence cbr-miR-79 |
|
Accession | MIMAT0000486 |
Sequence |
57 - auaaagcuagguuaccaaagcu - 78 |
Evidence | by similarity; MI0000050 |
References |
|
1 |
PMID:11679671
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|