Stem-loop sequence MI0000514

Accession MI0000514
ID cbr-mir-75
Description Caenorhabditis briggsae miR-75 stem-loop
Stem-loop 
u    ga -   a   c  u      ca     c    -  --   a 
 gcga  c cga uug ag cgguug  agcuu aaua ca  gac a
 ||||  | ||| ||| || ||||||  ||||| |||| ||  |||  
 cgcu  g gcu aac uc gccaac  ucgaa uuau gu  uug u
g    ac u   a   u  c      ca     a    a  uc   g
Get sequence
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (WS200) Overlapping transcripts
X: 4486715-4486806 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-75
cbr-mir-73 X: 4493863-4493956 [-]
cbr-mir-74b X: 4493687-4493803 [-]
cbr-mir-74 X: 4493578-4493658 [-]
cbr-mir-75 X: 4486715-4486806 [-]
Gene family

MIPF0000273; mir-75

Mature sequence MIMAT0000484

Accession MIMAT0000484
ID cbr-miR-75
Sequence

57 -  

uuaaagcuaccaaccgccuuca

 - 78

Get sequence
Evidence by similarity; MI0000046
Predicted targets

References

1
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).