Stem-loop sequence cbr-mir-52

AccessionMI0000505 (change log)
DescriptionCaenorhabditis briggsae miR-52 stem-loop
Gene family MIPF0000160; mir-52
Stem-loop
   u    c    --    a u c      a   a   uuc    c    cau 
5'  uucc gcuc  ugac g c acccgu cau ugu   cgug uuga   a
    |||| ||||  |||| | | |||||| ||| |||   |||| ||||    
3'  aagg ugag  acug c g ugggcg gua aca   gcac aacu   g
   c    c    cu    g c a      a   -   -ua    u    cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIV: 7363013-7363110 [+]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-52
cbr-mir-52chrIV: 7363013-7363110 [+]
cbr-mir-51chrIV: 7366589-7366733 [+]
Database links

Mature sequence cbr-miR-52

Accession MIMAT0000476
Sequence

19 - 

cacccguacauauguuuccgugcu

 - 42

Get sequence
Evidence by similarity; MI0000023

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).