|
miRBase |
|
Stem-loop sequence MI0000503 |
|||||
| Accession | MI0000503 | ||||
| ID | cbr-mir-49 | ||||
| Description | Caenorhabditis briggsae miR-49 stem-loop | ||||
| Stem-loop |
- cauuug c a u c c - au accgaaac ccauc gcaguuuuuugu g gugcu cg gc c c |||||||| ||||| |||||||||||| | ||||| || || | ugguuuug gguag cgucgaagagca c cacga gc cg g u u ----aa a - - a c u au |
||||
| Comments |
This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae. |
||||
| Genome context |
|
||||
| Gene family |
MIPF0000237; mir-49 |
||||
Mature sequence MIMAT0000474 |
|
| Accession | MIMAT0000474 |
| ID | cbr-miR-49 |
| Sequence |
61 - aagcaccacgagaagcugcaga - 82 |
| Evidence | by similarity; MI0000020 |
| Predicted targets |
|
References |
|
| 1 |
"An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans"
Science. 294:858-862(2001).
|