Stem-loop sequence cbr-mir-47

Accession

MI0000501

Description

Caenorhabditis briggsae miR-47 stem-loop

Gene family

MIPF0000087; mir-46

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-46/mir-47/mir-281_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, mir-46 (MI0000017) and mir-47 (MI0000018) are microRNA expressed in C. elegans from related hairpin precursor sequences. The predicted hairpin precursor sequences for Drosophila mir-281 (MI0000366, MI0000370) are also related and, hence, belong to this family. The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequences are expressed from the 3' arms of the hairpin precursors.

Stem-loop

u    -   gaaga           -     uu       ------   a 
 agcu gag     cugaagggagc uuucu  ugacagu      ucg u
 |||| |||     ||||||||||| |||||  |||||||      |||  
 ucgg cuc     gacuucucucg ggagg  acuguca      agc u
c    u   aagug           c     -u       uucuca   u 

Deep sequencing

56 reads, 1 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context

• Coordinates (WS200): chrX: 19620645-19620737 [+]
• Overlapping transcripts:

  intergenic

Mature sequence cbr-miR-47

• Accession: MIMAT0000472
• Sequence: 57 - ugucauggaggcgcucucuuca - 78
• Deep sequencing: 56 reads, 1 experiments
• Evidence: by similarity; MI0000018

References

1. PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).