Stem-loop sequence cbr-mir-47

AccessionMI0000501 (change log)
DescriptionCaenorhabditis briggsae miR-47 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   u    -   gaaga           -     uu       ------   a 
5'  agcu gag     cugaagggagc uuucu  ugacagu      ucg u
    |||| |||     ||||||||||| |||||  |||||||      |||  
3'  ucgg cuc     gacuucucucg ggagg  acuguca      agc u
   c    u   aagug           c     -u       uucuca   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 19747134-19747226 [+]
intergenic
Database links

Mature sequence cbr-miR-47

Accession MIMAT0000472
Sequence

57 - 

ugucauggaggcgcucucuuca

 - 78

Get sequence
Evidence by similarity; MI0000018

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).