Stem-loop sequence cbr-mir-45-1

AccessionMI0000498 (change log)
DescriptionCaenorhabditis briggsae miR-45-1 stem-loop
Gene family MIPF0000132; mir-44
Stem-loop
   a      c          -   gu         uaa   c u 
5'  gugcca gcuggaugug cuc  uagucauag   ccu a c
    |||||| |||||||||| |||  |||||||||   ||| | a
3'  cgcggu cgacuuacac gag  aucaguauu   gga u a
   c      u          a   --         --c   c u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrII: 8900352-8900433 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-45-1
cbr-mir-45-2chrII: 8903145-8903226 [+]
cbr-mir-45-1chrII: 8900352-8900433 [-]
cbr-mir-42chrII: 8891358-8891453 [-]
cbr-mir-43chrII: 8891204-8891298 [-]
cbr-mir-44chrII: 8891054-8891148 [-]
Database links

Mature sequence cbr-miR-45

Accession MIMAT0000470
Sequence

55 - 

ugacuagagacacauucagcu

 - 75

Get sequence
Evidence by similarity; MI0000016

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).