Stem-loop sequence cbr-mir-44

AccessionMI0000497 (change log)
DescriptionCaenorhabditis briggsae miR-44 stem-loop
Gene family MIPF0000132; mir-44
Stem-loop
   -    --a       u         -   gu        -   gaa   c 
5'  gaga   gggccga cuggaugug cuc  uagucaua gac   uca a
    ||||   ||||||| ||||||||| |||  |||||||| |||   |||  
3'  cucu   uccgguu gacuuacac gag  aucaguau cug   agu c
   a    agg       c         a   --        a   gaa   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrII: 8891054-8891148 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-44
cbr-mir-45-1chrII: 8900352-8900433 [-]
cbr-mir-42chrII: 8891358-8891453 [-]
cbr-mir-43chrII: 8891204-8891298 [-]
cbr-mir-44chrII: 8891054-8891148 [-]
Database links

Mature sequence cbr-miR-44

Accession MIMAT0000469
Sequence

61 - 

ugacuagagacacauucagcu

 - 81

Get sequence
Evidence by similarity; MI0000015

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).