Stem-loop sequence cbr-mir-43

AccessionMI0000496 (change log)
DescriptionCaenorhabditis briggsae miR-43 stem-loop
Gene family MIPF0000234; mir-43
Literature search

1 open access papers mention cbr-mir-43
(2 sentences)

Stem-loop
   a      --      c      u    -au   u     u   - gaaa 
5'  ggcgau  ucugcc gugaca caag   gcu gugau aug c    a
    ||||||  |||||| |||||| ||||   ||| ||||| ||| |    u
3'  ucguua  aggcgg cgcugu guuc   uga cacua uac g    g
   a      uu      a      c    auu   -     -   a gguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrII: 8891204-8891298 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-43
cbr-mir-45-1chrII: 8900352-8900433 [-]
cbr-mir-42chrII: 8891358-8891453 [-]
cbr-mir-43chrII: 8891204-8891298 [-]
cbr-mir-44chrII: 8891054-8891148 [-]
Database links

Mature sequence cbr-miR-43

Accession MIMAT0000468
Sequence

57 - 

uaucacaguuuacuugcugucgc

 - 79

Get sequence
Evidence by similarity; MI0000014

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).