Stem-loop sequence cbr-mir-34

AccessionMI0000494 (change log)
DescriptionCaenorhabditis briggsae miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   a  c   -    g   -u a       -u   u     g   -  u  a 
5'  ag acu caug ucg  g ggcagug  ggu agcug uug ca ac c
    || ||| |||| |||  | |||||||  ||| ||||| ||| || ||  
3'  uc uga guac agc  c ccgucac  cca ucggc aac gu ug a
   c  c   u    a   cc a       uu   -     -   a  -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 3832359-3832451 [+]
intergenic
Database links

Mature sequence cbr-miR-34

Accession MIMAT0000466
Sequence

18 - 

aggcagugugguuagcugguug

 - 39

Get sequence
Evidence by similarity; MI0000005

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).