Stem-loop sequence cbr-mir-1

AccessionMI0000493 (change log)
DescriptionCaenorhabditis briggsae miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

2 open access papers mention cbr-mir-1
(23 sentences)

Stem-loop
   u     -----g   ag           c      gc     -    ac 
5'  gcugu      ccg  cugcauacuuc uuacau  ccaua cugu  u
    |||||      |||  ||||||||||| ||||||  ||||| ||||  g
3'  cggca      ggc  gauguaugaag aaugua  gguau ggua  u
   g     aucuaa   aa           a      -a     a    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrI: 9430166-9430259 [-]
intergenic
Database links

Mature sequence cbr-miR-1

Accession MIMAT0000465
Sequence

56 - 

uggaauguaaagaaguaugua

 - 76

Get sequence
Evidence by similarity; MI0000003

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).