Stem-loop sequence cbr-mir-1

Accession MI0000493
Description Caenorhabditis briggsae miR-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u     -----g   ag           c      gc     -    ac 
 gcugu      ccg  cugcauacuuc uuacau  ccaua cugu  u
 |||||      |||  ||||||||||| ||||||  ||||| ||||  g
 cggca      ggc  gauguaugaag aaugua  gguau ggua  u
g     aucuaa   aa           a      -a     a    ag 
Get sequence
Deep sequencing
12 reads, 1 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from C. elegans [1,2]. The expression of this miRNA has not been verified in C. briggsae.

Genome context
Coordinates (WS200) Overlapping transcripts
chrI: 7435815-7435908 [-]
intergenic

Mature sequence cbr-miR-1

Accession MIMAT0000465
Sequence

56 - 

uggaauguaaagaaguaugua

 - 76

Get sequence
Evidence by similarity; MI0000003

References

1
PMID:11679671 "An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans" Lau NC, Lim LP, Weinstein EG, Bartel DP Science. 294:858-862(2001).
2
PMID:11679672 "An extensive class of small RNAs in Caenorhabditis elegans" Lee RC, Ambros V Science. 294:862-864(2001).