Stem-loop sequence hsa-mir-206

AccessionMI0000490 (change log)
Symbol HGNC:MIR206
DescriptionHomo sapiens miR-206 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
   u    c                        cc     u g uu 
5'  gcuu ccgaggccacaugcuucuuuauau  ccaua g a  a
    |||| ||||||||||||||||||||||||  ||||| | |   
3'  ugaa ggcuuuggugugugaaggaaugua  gguau c u  c
   g    c                        -a     - g uu 
Get sequence
Deep sequencing
1558 reads, 907 reads per million, 46 experiments
Feedback: Do you believe this miRNA is real?

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 52144349-52144434 [+]
OTTHUMT00000470784 ; MCM3-006; exon 5
OTTHUMT00000040897 ; MCM3-001; exon 5
ENST00000419835 ; MCM3-201; exon 4
ENST00000229854 ; MCM3-006; exon 5
ENST00000596288 ; MCM3-001; exon 5
Clustered miRNAs
< 10kb from hsa-mir-206
hsa-mir-206chr6: 52144349-52144434 [+]
hsa-mir-133bchr6: 52148923-52149041 [+]
Database links

Mature sequence hsa-miR-206

Accession MIMAT0000462

53 - 


 - 74

Get sequence
Deep sequencing1557 reads, 47 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets


PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).