Stem-loop sequence hsa-mir-206

AccessionMI0000490 (change log)
Symbol HGNC:MIR206
DescriptionHomo sapiens miR-206 stem-loop
Gene family MIPF0000038; mir-1
Literature search

292 open access papers mention hsa-mir-206
(1926 sentences)

Stem-loop
   u    c                        cc     u g uu 
5'  gcuu ccgaggccacaugcuucuuuauau  ccaua g a  a
    |||| ||||||||||||||||||||||||  ||||| | |   
3'  ugaa ggcuuuggugugugaaggaaugua  gguau c u  c
   g    c                        -a     - g uu 
Get sequence
Deep sequencing
45586 reads, 375 reads per million, 124 experiments
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 52144349-52144434 [+]
antisense
OTTHUMT00000470784 ; MCM3-006; exon 5
OTTHUMT00000040897 ; MCM3-001; exon 5
ENST00000419835 ; MCM3-201; exon 4
ENST00000229854 ; MCM3-006; exon 5
ENST00000596288 ; MCM3-001; exon 5
Clustered miRNAs
< 10kb from hsa-mir-206
hsa-mir-206chr6: 52144349-52144434 [+]
hsa-mir-133bchr6: 52148923-52149041 [+]
Database links

Mature sequence hsa-miR-206

Accession MIMAT0000462
Sequence

53 - 

uggaauguaaggaagugugugg

 - 74

Get sequence
Deep sequencing45583 reads, 125 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).