Stem-loop sequence hsa-mir-195

AccessionMI0000489 (change log)
Symbol HGNC:MIR195
DescriptionHomo sapiens miR-195 stem-loop
Gene family MIPF0000006; mir-15
Literature search

231 open access papers mention hsa-mir-195
(1837 sentences)

Stem-loop
   a   u     g  cu          -a          caggga 
5'  gcu cccug cu  agcagcacag  aauauuggca      a
    ||| ||||| ||  ||||||||||  ||||||||||       
3'  ugg gggac ga  ucgucguguc  uuauaaccgu      g
   g   u     g  cc          gg          cugagc 
Get sequence
Deep sequencing
1036831 reads, 2.03e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 7017615-7017701 [-]
sense
OTTHUMT00000220003 ; ASGR2-002; 5'UTR (exon 2)
OTTHUMT00000220002 ; ASGR2-001; 5'UTR (exon 2)
OTTHUMT00000439920 ; ASGR2-005; exon 2
OTTHUMT00000439921 ; ASGR2-006; exon 3
OTTHUMT00000439938 ; ASGR2-007; 5'UTR (exon 4)
ENST00000355035 ; ASGR2-002; 5'UTR (exon 2)
ENST00000254850 ; ASGR2-001; 5'UTR (exon 2)
ENST00000576487 ; ASGR2-005; exon 2
ENST00000380952 ; ASGR2-201; 5'UTR (exon 2)
ENST00000450034 ; ASGR2-006; exon 3
ENST00000574868 ; ASGR2-007; 5'UTR (exon 4)
Clustered miRNAs
< 10kb from hsa-mir-195
hsa-mir-497chr17: 7017911-7018022 [-]
hsa-mir-195chr17: 7017615-7017701 [-]
Database links

Mature sequence hsa-miR-195-5p

Accession MIMAT0000461
Previous IDshsa-miR-195
Sequence

15 - 

uagcagcacagaaauauuggc

 - 35

Get sequence
Deep sequencing1034422 reads, 159 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-195-3p

Accession MIMAT0004615
Previous IDshsa-miR-195*
Sequence

53 - 

ccaauauuggcugugcugcucc

 - 74

Get sequence
Deep sequencing2121 reads, 104 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).