Stem-loop sequence hsa-mir-194-1

Accession MI0000488
Previous IDs hsa-mir-194
Symbol HGNC:MIR194-1
Description Homo sapiens miR-194-1 stem-loop
Gene family MIPF0000055; mir-194
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
a    - uu      u         a      g    cu  gu 
 uggu g  aucaag guaacagca cuccau ugga  gu  a
 |||| |  |||||| ||||||||| |||||| ||||  ||   
 acca u  uaguuu cauugucgu gaggug accu  ua  c
a    u gg      u         a      -    -u  ac
Get sequence
Deep sequencing
415 reads, 30 experiments
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MI0000236 ) on chromosome 1, and mir-194-2 (MI0000733 ) on chromosome 19) and human (mir-194-1 (MI0000488 ) on chromosome 1, and mir-194-2 (MI0000732 ) on chromosome 11).

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 220291499-220291583 [-]
antisense
OTTHUMT00000090763 ; IARS2-003; intron 1
OTTHUMT00000090763 ; IARS2-003; intron 1
OTTHUMT00000090763 ; IARS2-003; intron 1
OTTHUMT00000090761 ; IARS2-001; intron 12
OTTHUMT00000090761 ; IARS2-001; intron 12
OTTHUMT00000090761 ; IARS2-001; intron 12
ENST00000490891 ; IARS2-003; intron 1
ENST00000490891 ; IARS2-003; intron 1
ENST00000490891 ; IARS2-003; intron 1
ENST00000366922 ; IARS2-001; intron 12
ENST00000302637 ; IARS2-201; intron 12
ENST00000366922 ; IARS2-001; intron 12
ENST00000302637 ; IARS2-201; intron 12
ENST00000366922 ; IARS2-001; intron 12
ENST00000302637 ; IARS2-201; intron 12
Clustered miRNAs
< 10kb from hsa-mir-194-1
hsa-mir-194-1 chr1: 220291499-220291583 [-]
hsa-mir-215 chr1: 220291195-220291304 [-]
Database links

Mature sequence hsa-miR-194-5p

Accession MIMAT0000460
Previous IDs hsa-miR-194
Sequence

15 -  

uguaacagcaacuccaugugga

 - 36

Get sequence
Deep sequencing 659 reads, 39 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).