|
miRBase |
|
Stem-loop sequence hsa-mir-194-1 |
||||||
| Accession | MI0000488 | |||||
| Previous IDs | hsa-mir-194 | |||||
| Symbol | HGNC:MIR194-1 | |||||
| Description | Homo sapiens miR-194-1 stem-loop | |||||
| Gene family | MIPF0000055; mir-194 | |||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-194_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... In molecular biology, miR-194 microRNA precursor is a small non-coding RNA gene that regulated gene expression. Its expression has been verified in mouse (MI0000236, MI0000733) and in human (MI0000488, MI0000732). mir-194 appears to be a vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000055). The mature microRNA is processed from the longer hairpin precursor by the Dicer enzyme. In this case, the mature sequence is excised from the 5' arm of the hairpin. |
|||||
| Stem-loop |
a - uu u a g cu gu uggu g aucaag guaacagca cuccau ugga gu a |||| | |||||| ||||||||| |||||| |||| || acca u uaguuu cauugucgu gaggug accu ua c a u gg u a - -u ac |
|||||
| Deep sequencing |
| |||||
| Comments |
This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-194 in human [2]. Two putative pairs of orthologous hairpin precursors structures are found in mouse (mir-194-1 (MI0000236 ) on chromosome 1, and mir-194-2 (MI0000733 ) on chromosome 19) and human (mir-194-1 (MI0000488 ) on chromosome 1, and mir-194-2 (MI0000732 ) on chromosome 11). |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
Mature sequence hsa-miR-194-5p |
|
| Accession | MIMAT0000460 |
| Previous IDs | hsa-miR-194 |
| Sequence |
15 - uguaacagcaacuccaugugga - 36 |
| Deep sequencing | 659 reads, 39 experiments |
| Evidence | experimental; cloned [2-3] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:12554859
"New microRNAs from mouse and human"
RNA. 9:175-179(2003).
|
| 2 |
PMID:14573789
"Reduced accumulation of specific microRNAs in colorectal neoplasia"
Mol Cancer Res. 1:882-891(2003).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|