Stem-loop sequence hsa-mir-193a

AccessionMI0000487 (change log)
Previous IDshsa-mir-193
Symbol HGNC:MIR193A
DescriptionHomo sapiens miR-193a stem-loop
Gene family MIPF0000082; mir-193
Literature search

148 open access papers mention hsa-mir-193a
(983 sentences)

Stem-loop
   cgaggau   a             u     cg   g  a   gggu 
5'        ggg gcugagggcuggg cuuug  ggc ag uga    g
          ||| ||||||||||||| |||||  ||| || |||     
3'        ccc cggcucuugaccc gaaac  ccg uc acu    u
   ------g   c             u     au   g  a   aggc 
Get sequence
Deep sequencing
118699 reads, 540 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 31559996-31560083 [+]
antisense
OTTHUMT00000256378 ; ASIC2-001; intron 1
OTTHUMT00000447552 ; ASIC2-003; intron 1
OTTHUMT00000447553 ; ASIC2-004; intron 1
OTTHUMT00000256379 ; ASIC2-002; intron 2
ENST00000225823 ; ASIC2-001; intron 1
ENST00000359872 ; ASIC2-003; intron 1
ENST00000579816 ; ASIC2-004; intron 1
ENST00000448983 ; ASIC2-002; intron 2
Database links

Mature sequence hsa-miR-193a-5p

Accession MIMAT0004614
Sequence

21 - 

ugggucuuugcgggcgagauga

 - 42

Get sequence
Deep sequencing46220 reads, 156 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-193a-3p

Accession MIMAT0000459
Previous IDshsa-miR-193;hsa-miR-193a
Sequence

55 - 

aacuggccuacaaagucccagu

 - 76

Get sequence
Deep sequencing72316 reads, 158 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).