Stem-loop sequence hsa-mir-193a

Accession

MI0000487

Previous IDs

hsa-mir-193

Symbol

HGNC:MIR193A

Description

Homo sapiens miR-193a stem-loop

Gene family

MIPF0000082; mir-193

Stem-loop

cgaggau   a             u     cg   g  a   gggu 
       ggg gcugagggcuggg cuuug  ggc ag uga    g
       ||| ||||||||||||| |||||  ||| || |||     
       ccc cggcucuugaccc gaaac  ccg uc acu    u
------g   c             u     au   g  a   aggc 

Deep sequencing

9553 reads, 40 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

• Coordinates (GRCh37.p5): chr17: 29887015-29887102 [+]
• Overlapping transcripts:

  intergenic

Database links

• ENTREZGENE: 406968;MIR193A
• HGNC: 31563;MIR193A

Mature sequence hsa-miR-193a-5p

• Accession: MIMAT0004614
• Sequence: 21 - ugggucuuugcgggcgagauga - 42
• Deep sequencing: 7199 reads, 28 experiments
• Evidence: experimental; cloned [2-3]
• Validated targets:
  • MIRTARBASE:hsa-miR-193a-5p
  • TARBASE:hsa-miR-193a-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-193a-5p
  • MICRORNA.ORG:hsa-miR-193a-5p
  • MIRDB:hsa-miR-193a-5p
  • RNA22-HSA:hsa-miR-193a-5p
  • TARGETMINER:hsa-miR-193a-5p
  • TARGETSCAN-VERT:hsa-miR-193a-5p

Mature sequence hsa-miR-193a-3p

• Accession: MIMAT0000459
• Previous IDs: hsa-miR-193;hsa-miR-193a
• Sequence: 55 - aacuggccuacaaagucccagu - 76
• Deep sequencing: 2329 reads, 38 experiments
• Evidence: experimental; cloned [2-3]
• Validated targets:
  • MIRECORDS:hsa-miR-193a-3p
  • MIRTARBASE:hsa-miR-193a-3p
  • TARBASE:hsa-miR-193a-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-193a-3p
  • MICRORNA.ORG:hsa-miR-193a-3p
  • MIRDB:hsa-miR-193a-3p
  • RNA22-HSA:hsa-miR-193a-3p
  • TARGETMINER:hsa-miR-193a-3p
  • TARGETSCAN-VERT:hsa-miR-193a-3p

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).