Stem-loop sequence hsa-mir-190a

AccessionMI0000486 (change log)
Previous IDshsa-mir-190
Symbol HGNC:MIR190A
DescriptionHomo sapiens miR-190a stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   u     c u    - ug               ua     uuau 
5'  gcagg c cugu g  auauguuugauauau  gguug    u
    ||||| | |||| |  |||||||||||||||  |||||     
3'  cguuc g gaca c  uauacaaacuauaua  ucaac    u
   c     u u    u cu               --     cuaa 
Get sequence
Deep sequencing
4579 reads, 16.1 reads per million, 56 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 62823957-62824041 [+]
sense
OTTHUMT00000416579 ; TLN2-008; intron 1
ENST00000561197 ; TLN2-008; intron 1
Database links

Mature sequence hsa-miR-190a-5p

Accession MIMAT0000458
Previous IDshsa-miR-190
Sequence

15 - 

ugauauguuugauauauuaggu

 - 36

Get sequence
Deep sequencing4270 reads, 51 experiments
Evidence experimental; cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-190a-3p

Accession MIMAT0026482
Sequence

52 - 

cuauauaucaaacauauuccu

 - 72

Get sequence
Deep sequencing309 reads, 37 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).