Stem-loop sequence hsa-mir-188

AccessionMI0000484 (change log)
Symbol HGNC:MIR188
DescriptionHomo sapiens miR-188 stem-loop
Gene family MIPF0000113; mir-188
Literature search

58 open access papers mention hsa-mir-188
(324 sentences)

Stem-loop
   u    -  uc   ca  uc         gu      -ugag u 
5'  gcuc cc  ucu  ca  ccuugcaug  ggaggg     c u
    |||| ||  |||  ||  |||||||||  ||||||     | u
3'  cgag gg  agg  gu  gggacguac  ccuccc     g c
   c    c  -u   ac  uu         ac      caaaa u 
Get sequence
Deep sequencing
10083 reads, 28.7 reads per million, 150 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 50003503-50003588 [+]
sense
OTTHUMT00000056562 ; CCNB3-005; intron 1
OTTHUMT00000056558 ; CCNB3-001; intron 1
OTTHUMT00000056559 ; CCNB3-002; intron 1
OTTHUMT00000056560 ; CCNB3-003; intron 1
OTTHUMT00000056561 ; CCNB3-004; intron 2
ENST00000491907 ; CCNB3-005; intron 1
ENST00000376042 ; CCNB3-001; intron 1
ENST00000376038 ; CCNB3-002; intron 1
ENST00000476167 ; CCNB3-003; intron 1
ENST00000493507 ; CCNB3-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-188
hsa-mir-532chrX: 50003148-50003238 [+]
hsa-mir-188chrX: 50003503-50003588 [+]
hsa-mir-500achrX: 50008431-50008514 [+]
hsa-mir-362chrX: 50008964-50009028 [+]
hsa-mir-501chrX: 50009722-50009805 [+]
hsa-mir-500bchrX: 50010672-50010750 [+]
hsa-mir-660chrX: 50013241-50013337 [+]
Database links

Mature sequence hsa-miR-188-5p

Accession MIMAT0000457
Previous IDshsa-miR-188
Sequence

15 - 

caucccuugcaugguggaggg

 - 35

Get sequence
Deep sequencing8880 reads, 145 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-188-3p

Accession MIMAT0004613
Sequence

54 - 

cucccacaugcaggguuugca

 - 74

Get sequence
Deep sequencing1194 reads, 102 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).