Stem-loop sequence hsa-mir-188

AccessionMI0000484
Symbol HGNC:MIR188
DescriptionHomo sapiens miR-188 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
   u    -  uc   ca  uc         gu      -ugag u 
5'  gcuc cc  ucu  ca  ccuugcaug  ggaggg     c u
    |||| ||  |||  ||  |||||||||  ||||||     | u
3'  cgag gg  agg  gu  gggacguac  ccuccc     g c
   c    c  -u   ac  uu         ac      caaaa u 
Get sequence
Deep sequencing
1728 reads, 642 reads per million, 57 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chrX: 50003503-50003588 [+]
sense
OTTHUMT00000056562 ; CCNB3-005; intron 1
OTTHUMT00000056558 ; CCNB3-001; intron 1
OTTHUMT00000056559 ; CCNB3-002; intron 1
OTTHUMT00000056560 ; CCNB3-003; intron 1
OTTHUMT00000056561 ; CCNB3-004; intron 2
ENST00000491907 ; CCNB3-005; intron 1
ENST00000376042 ; CCNB3-001; intron 1
ENST00000376038 ; CCNB3-002; intron 1
ENST00000476167 ; CCNB3-003; intron 1
ENST00000493507 ; CCNB3-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-188
hsa-mir-532chrX: 50003148-50003238 [+]
hsa-mir-188chrX: 50003503-50003588 [+]
hsa-mir-500achrX: 50008431-50008514 [+]
hsa-mir-362chrX: 50008964-50009028 [+]
hsa-mir-501chrX: 50009722-50009805 [+]
hsa-mir-500bchrX: 50010672-50010750 [+]
hsa-mir-660chrX: 50013241-50013337 [+]
Database links

Mature sequence hsa-miR-188-5p

Accession MIMAT0000457
Previous IDshsa-miR-188
Sequence

15 - 

caucccuugcaugguggaggg

 - 35

Get sequence
Deep sequencing257 reads, 38 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-188-3p

Accession MIMAT0004613
Sequence

54 - 

cucccacaugcaggguuugca

 - 74

Get sequence
Deep sequencing93 reads, 24 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).