Stem-loop sequence hsa-mir-186

AccessionMI0000483
Symbol HGNC:MIR186
DescriptionHomo sapiens miR-186 stem-loop
Gene family MIPF0000109; mir-186
Stem-loop
   u     u                 u     u      ucuggu 
5'  gcuug aacuuuccaaagaauuc ccuuu gggcuu      u
    ||||| ||||||||||||||||| ||||| ||||||       
3'  cgagu uugaaggguuuuuuaag ggaaa cccgaa      u
   u     -                 u     -      uuuuau 
Get sequence
Deep sequencing
34085 reads, 2.37e+03 reads per million, 70 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse. Expression of this miRNA was also verified in a human osteoblast sarcoma cell line [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 71067631-71067716 [-]
intergenic
Database links

Mature sequence hsa-miR-186-5p

Accession MIMAT0000456
Previous IDshsa-miR-186
Sequence

15 - 

caaagaauucuccuuuugggcu

 - 36

Get sequence
Deep sequencing7069 reads, 64 experiments
Evidence experimental; cloned [1-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-186-3p

Accession MIMAT0004612
Previous IDshsa-miR-186*
Sequence

54 - 

gcccaaaggugaauuuuuuggg

 - 75

Get sequence
Deep sequencing136 reads, 33 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).