Stem-loop sequence hsa-mir-185

AccessionMI0000482
Symbol HGNC:MIR185
DescriptionHomo sapiens miR-185 stem-loop
Gene family MIPF0000202; mir-185
Stem-loop
   a     c       ug   a     g         au  uc 
5'  ggggg gagggau  gag gaaag caguuccug  gg  c
    ||||| |||||||  ||| ||||| |||||||||  ||   
3'  cccuc cuuccug  cuc cuuuc gucggggac  cc  c
   a     c       gu   -     g         -c  uc 
Get sequence
Deep sequencing
48635 reads, 5.32e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr22: 20033139-20033220 [+]
sense
OTTHUMT00000318762 ; TANGO2-019; intron 2
OTTHUMT00000318735 ; TANGO2-015; intron 2
OTTHUMT00000319787 ; TANGO2-021; intron 2
OTTHUMT00000319786 ; TANGO2-013; intron 2
OTTHUMT00000318761 ; TANGO2-018; intron 3
OTTHUMT00000318687 ; TANGO2-001; intron 3
OTTHUMT00000318727 ; TANGO2-009; intron 3
OTTHUMT00000318728 ; TANGO2-010; intron 3
OTTHUMT00000318725 ; TANGO2-007; intron 3
OTTHUMT00000318690 ; TANGO2-004; intron 3
OTTHUMT00000318729 ; TANGO2-011; intron 3
OTTHUMT00000318688 ; TANGO2-002; intron 3
OTTHUMT00000318689 ; TANGO2-003; intron 3
OTTHUMT00000318726 ; TANGO2-008; intron 3
OTTHUMT00000318730 ; TANGO2-012; intron 3
OTTHUMT00000318691 ; TANGO2-005; intron 3
OTTHUMT00000318732 ; TANGO2-014; intron 3
OTTHUMT00000318692 ; TANGO2-006; intron 4
ENST00000462579 ; TANGO2-019; intron 2
ENST00000444651 ; TANGO2-015; intron 2
ENST00000484373 ; TANGO2-021; intron 2
ENST00000485715 ; TANGO2-013; intron 2
ENST00000434570 ; TANGO2-203; intron 2
ENST00000456048 ; TANGO2-205; intron 2
ENST00000420290 ; TANGO2-201; intron 2
ENST00000471707 ; TANGO2-018; intron 3
ENST00000401886 ; TANGO2-001; intron 3
ENST00000475446 ; TANGO2-009; intron 3
ENST00000411907 ; TANGO2-010; intron 3
ENST00000398042 ; TANGO2-007; intron 3
ENST00000399807 ; TANGO2-004; intron 3
ENST00000450664 ; TANGO2-011; intron 3
ENST00000450019 ; TANGO2-002; intron 3
ENST00000327374 ; TANGO2-003; intron 3
ENST00000479679 ; TANGO2-008; intron 3
ENST00000430807 ; TANGO2-012; intron 3
ENST00000401833 ; TANGO2-005; intron 3
ENST00000434168 ; TANGO2-014; intron 3
ENST00000432883 ; TANGO2-202; intron 3
ENST00000432198 ; TANGO2-006; intron 4
ENST00000447208 ; TANGO2-204; intron 4
Database links

Mature sequence hsa-miR-185-5p

Accession MIMAT0000455
Previous IDshsa-miR-185
Sequence

15 - 

uggagagaaaggcaguuccuga

 - 36

Get sequence
Deep sequencing961 reads, 60 experiments
Evidence experimental; cloned [2-4], Illumina [5]
Validated targets
Predicted targets

Mature sequence hsa-miR-185-3p

Accession MIMAT0004611
Previous IDshsa-miR-185*
Sequence

50 - 

aggggcuggcuuuccucugguc

 - 71

Get sequence
Deep sequencing1090 reads, 25 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5