Stem-loop sequence hsa-mir-185

Accession

MI0000482

Symbol

HGNC:MIR185

Description

Homo sapiens miR-185 stem-loop

Gene family

MIPF0000202; mir-185

Stem-loop

a     c       ug   a     g         au  uc 
 ggggg gagggau  gag gaaag caguuccug  gg  c
 ||||| |||||||  ||| ||||| |||||||||  ||   
 cccuc cuuccug  cuc cuuuc gucggggac  cc  c
a     c       gu   -     g         -c  uc 

Deep sequencing

167801 reads, 42 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh37.p5): chr22: 20020662-20020743 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000318761 ; C22orf25-018; intron 1

  OTTHUMT00000318687 ; C22orf25-001; intron 1

  OTTHUMT00000318727 ; C22orf25-009; intron 1

  OTTHUMT00000318728 ; C22orf25-010; intron 1

  OTTHUMT00000318725 ; C22orf25-007; intron 1

  OTTHUMT00000318690 ; C22orf25-004; intron 1

  OTTHUMT00000318729 ; C22orf25-011; intron 1

  OTTHUMT00000318688 ; C22orf25-002; intron 1

  OTTHUMT00000318689 ; C22orf25-003; intron 1

  OTTHUMT00000318726 ; C22orf25-008; intron 1

  OTTHUMT00000318730 ; C22orf25-012; intron 1

  OTTHUMT00000318691 ; C22orf25-005; intron 1

  OTTHUMT00000318732 ; C22orf25-014; intron 1

  OTTHUMT00000318761 ; C22orf25-018; intron 1

  OTTHUMT00000318687 ; C22orf25-001; intron 1

  OTTHUMT00000318727 ; C22orf25-009; intron 1

  OTTHUMT00000318728 ; C22orf25-010; intron 1

  OTTHUMT00000318725 ; C22orf25-007; intron 1

  OTTHUMT00000318690 ; C22orf25-004; intron 1

  OTTHUMT00000318729 ; C22orf25-011; intron 1

  OTTHUMT00000318688 ; C22orf25-002; intron 1

  OTTHUMT00000318689 ; C22orf25-003; intron 1

  OTTHUMT00000318726 ; C22orf25-008; intron 1

  OTTHUMT00000318730 ; C22orf25-012; intron 1

  OTTHUMT00000318691 ; C22orf25-005; intron 1

  OTTHUMT00000318732 ; C22orf25-014; intron 1

  OTTHUMT00000318761 ; C22orf25-018; intron 1

  OTTHUMT00000318687 ; C22orf25-001; intron 1

  OTTHUMT00000318727 ; C22orf25-009; intron 1

  OTTHUMT00000318728 ; C22orf25-010; intron 1

  OTTHUMT00000318725 ; C22orf25-007; intron 1

  OTTHUMT00000318690 ; C22orf25-004; intron 1

  OTTHUMT00000318729 ; C22orf25-011; intron 1

  OTTHUMT00000318688 ; C22orf25-002; intron 1

  OTTHUMT00000318689 ; C22orf25-003; intron 1

  OTTHUMT00000318726 ; C22orf25-008; intron 1

  OTTHUMT00000318730 ; C22orf25-012; intron 1

  OTTHUMT00000318691 ; C22orf25-005; intron 1

  OTTHUMT00000318732 ; C22orf25-014; intron 1

  OTTHUMT00000318692 ; C22orf25-006; intron 2

  OTTHUMT00000318692 ; C22orf25-006; intron 2

  OTTHUMT00000318692 ; C22orf25-006; intron 2

  ENST00000471707 ; C22orf25-018; intron 1

  ENST00000401886 ; C22orf25-001; intron 1

  ENST00000475446 ; C22orf25-009; intron 1

  ENST00000411907 ; C22orf25-010; intron 1

  ENST00000398042 ; C22orf25-007; intron 1

  ENST00000399807 ; C22orf25-004; intron 1

  ENST00000450664 ; C22orf25-011; intron 1

  ENST00000450019 ; C22orf25-002; intron 1

  ENST00000327374 ; C22orf25-003; intron 1

  ENST00000479679 ; C22orf25-008; intron 1

  ENST00000430807 ; C22orf25-012; intron 1

  ENST00000401833 ; C22orf25-005; intron 1

  ENST00000434168 ; C22orf25-014; intron 1

  ENST00000432883 ; C22orf25-202; intron 1

  ENST00000471707 ; C22orf25-018; intron 1

  ENST00000401886 ; C22orf25-001; intron 1

  ENST00000475446 ; C22orf25-009; intron 1

  ENST00000411907 ; C22orf25-010; intron 1

  ENST00000398042 ; C22orf25-007; intron 1

  ENST00000399807 ; C22orf25-004; intron 1

  ENST00000450664 ; C22orf25-011; intron 1

  ENST00000450019 ; C22orf25-002; intron 1

  ENST00000327374 ; C22orf25-003; intron 1

  ENST00000479679 ; C22orf25-008; intron 1

  ENST00000430807 ; C22orf25-012; intron 1

  ENST00000401833 ; C22orf25-005; intron 1

  ENST00000434168 ; C22orf25-014; intron 1

  ENST00000432883 ; C22orf25-202; intron 1

  ENST00000471707 ; C22orf25-018; intron 1

  ENST00000401886 ; C22orf25-001; intron 1

  ENST00000475446 ; C22orf25-009; intron 1

  ENST00000411907 ; C22orf25-010; intron 1

  ENST00000398042 ; C22orf25-007; intron 1

  ENST00000399807 ; C22orf25-004; intron 1

  ENST00000450664 ; C22orf25-011; intron 1

  ENST00000450019 ; C22orf25-002; intron 1

  ENST00000327374 ; C22orf25-003; intron 1

  ENST00000479679 ; C22orf25-008; intron 1

  ENST00000430807 ; C22orf25-012; intron 1

  ENST00000401833 ; C22orf25-005; intron 1

  ENST00000434168 ; C22orf25-014; intron 1

  ENST00000432883 ; C22orf25-202; intron 1

  ENST00000432198 ; C22orf25-006; intron 2

  ENST00000447208 ; C22orf25-204; intron 2

  ENST00000432198 ; C22orf25-006; intron 2

  ENST00000447208 ; C22orf25-204; intron 2

  ENST00000432198 ; C22orf25-006; intron 2

  ENST00000447208 ; C22orf25-204; intron 2

Database links

• ENTREZGENE: 406961;MIR185
• HGNC: 31556;MIR185

Mature sequence hsa-miR-185-5p

• Accession: MIMAT0000455
• Previous IDs: hsa-miR-185
• Sequence: 15 - uggagagaaaggcaguuccuga - 36
• Deep sequencing: 166797 reads, 40 experiments
• Evidence: experimental; cloned [2-4], Solexa [5]
• Validated targets:
  • TARBASE:hsa-miR-185-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-185-5p
  • MICRORNA.ORG:hsa-miR-185-5p
  • MIRDB:hsa-miR-185-5p
  • RNA22-HSA:hsa-miR-185-5p
  • TARGETMINER:hsa-miR-185-5p
  • TARGETSCAN-VERT:hsa-miR-185
  • PICTAR-VERT:hsa-miR-185

Mature sequence hsa-miR-185-3p

• Accession: MIMAT0004611
• Previous IDs: hsa-miR-185*
• Sequence: 50 - aggggcuggcuuuccucugguc - 71
• Deep sequencing: 1003 reads, 15 experiments
• Evidence: experimental; cloned [3]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-185-3p
  • MICRORNA.ORG:hsa-miR-185-3p
  • MIRDB:hsa-miR-185-3p
  • RNA22-HSA:hsa-miR-185-3p
  • TARGETMINER:hsa-miR-185-3p
  • PICTAR-VERT:hsa-miR-185

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
5. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).