Stem-loop sequence hsa-mir-184

AccessionMI0000481 (change log)
Symbol HGNC:MIR184
DescriptionHomo sapiens miR-184 stem-loop
Gene family MIPF0000059; mir-184
Literature search

126 open access papers mention hsa-mir-184
(966 sentences)

Stem-loop
   c       g c         c      a c     -    ug 
5'  cagucac u cccuuauca uuuucc g ccagc uuug  a
    ||||||| | ||||||||| |||||| | ||||| ||||   
3'  guuagug a gggaauagu aagagg c gguug gaau  c
   a       g u         c      - a     u    gu 
Get sequence
Deep sequencing
101942 reads, 128 reads per million, 129 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 79209788-79209871 [+]
intergenic
Database links

Mature sequence hsa-miR-184

Accession MIMAT0000454
Sequence

53 - 

uggacggagaacugauaagggu

 - 74

Get sequence
Deep sequencing96122 reads, 127 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).