Stem-loop sequence hsa-mir-184

Accession MI0000481
Symbol HGNC:MIR184
Description Homo sapiens miR-184 stem-loop
Gene family MIPF0000059; mir-184
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-184. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-184 microRNA is a short non-coding RNA molecule. MicroRNAs (miRNAs) function as posttranscriptional regulators of expression levels of other genes by several mechanisms. Several targets for miR-184 have been described, including that of mediators of neurological development, apoptosis and it has been suggested that miR-184 plays an essential role in development. MicroRNAs can bind to the three prime untranslated region (3’UTR) of the target messenger RNA (mRNA). Binding of the miRNA can hinder translation of mRNA by promoting degradation or inducing deadenylation.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c       g c         c      a c     -    ug 
 cagucac u cccuuauca uuuucc g ccagc uuug  a
 ||||||| | ||||||||| |||||| | ||||| ||||   
 guuagug a gggaauagu aagagg c gguug gaau  c
a       g u         c      - a     u    gu 
Get sequence
Deep sequencing
1104 reads, 24 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 79502130-79502213 [+]
antisense
OTTHUMT00000417802 ; RP11-17L5.4-008; intron 1
OTTHUMT00000417802 ; RP11-17L5.4-008; intron 1
OTTHUMT00000417803 ; RP11-17L5.4-006; intron 2
OTTHUMT00000417803 ; RP11-17L5.4-006; intron 2
ENST00000560872 ; RP11-17L5.4-008; intron 1
ENST00000560872 ; RP11-17L5.4-008; intron 1
ENST00000559225 ; RP11-17L5.4-006; intron 2
ENST00000559225 ; RP11-17L5.4-006; intron 2
Database links

Mature sequence hsa-miR-184

Accession MIMAT0000454
Sequence

53 - 

uggacggagaacugauaagggu

 - 74

Get sequence
Deep sequencing 1104 reads, 24 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).