Stem-loop sequence hsa-mir-154

AccessionMI0000480 (change log)
Symbol HGNC:MIR154
DescriptionHomo sapiens miR-154 stem-loop
Gene family MIPF0000018; mir-154
Literature search

59 open access papers mention hsa-mir-154
(142 sentences)

Stem-loop
   g       u            u      ugcc    - uuu 
5'  ugguacu gaagauagguua ccgugu    uucg c   a
    ||||||| |||||||||||| ||||||    |||| |   u
3'  accauga uuuuuauccagu ggcaca    aagc g   u
   a       c            u      uacu    a ugu 
Get sequence
Deep sequencing
6159 reads, 2.46 reads per million, 122 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101059755-101059838 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-154
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
hsa-mir-409chr14: 101065300-101065378 [+]
hsa-mir-412chr14: 101065447-101065537 [+]
hsa-mir-369chr14: 101065598-101065667 [+]
hsa-mir-410chr14: 101065912-101065991 [+]
hsa-mir-656chr14: 101066724-101066801 [+]
Database links

Mature sequence hsa-miR-154-5p

Accession MIMAT0000452
Previous IDshsa-miR-154
Sequence

15 - 

uagguuauccguguugccuucg

 - 36

Get sequence
Deep sequencing3783 reads, 110 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

Mature sequence hsa-miR-154-3p

Accession MIMAT0000453
Previous IDshsa-miR-154*
Sequence

51 - 

aaucauacacgguugaccuauu

 - 72

Get sequence
Deep sequencing2376 reads, 114 experiments
Evidence experimental; cloned [2,4], Northern [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).