Stem-loop sequence hsa-mir-150

Accession MI0000479
Symbol HGNC:MIR150
Description Homo sapiens miR-150 stem-loop
Gene family MIPF0000197; mir-150
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-150. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-150 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-150 functions in hematopoiesis; it regulates genes whose downstream products encourage differentiating stem cells towards becoming megakaryocytes rather than erythrocytes. It is also thought to control B and T cell differentiation, alongside mir-155.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c      u  -            ac   u       u -   g 
 ucccca gg cccugucuccca  ccu guaccag g cug g
 |||||| || ||||||||||||  ||| ||||||| | |||  
 aggggu cc gggacagggggu  gga caugguc c gac c
c      -  a            cc   -       c a   u 
Get sequence
Deep sequencing
80 reads, 16 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 50004042-50004125 [-]
intergenic
Database links

Mature sequence hsa-miR-150-5p

Accession MIMAT0000451
Previous IDs hsa-miR-150
Sequence

16 - 

ucucccaacccuuguaccagug

 - 37

Get sequence
Deep sequencing 74 reads, 15 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-150-3p

Accession MIMAT0004610
Previous IDs hsa-miR-150*
Sequence

51 - 

cugguacaggccugggggacag

 - 72

Get sequence
Deep sequencing 5 reads, 3 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).