Stem-loop sequence hsa-mir-150

AccessionMI0000479 (change log)
Symbol HGNC:MIR150
DescriptionHomo sapiens miR-150 stem-loop
Gene family MIPF0000197; mir-150
Literature search

317 open access papers mention hsa-mir-150
(2107 sentences)

Stem-loop
   c      u  -            ac   u       u -   g 
5'  ucccca gg cccugucuccca  ccu guaccag g cug g
    |||||| || ||||||||||||  ||| ||||||| | |||  
3'  aggggu cc gggacagggggu  gga caugguc c gac c
   c      -  a            cc   -       c a   u 
Get sequence
Deep sequencing
123171 reads, 699 reads per million, 137 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 49500785-49500868 [-]
antisense
OTTHUMT00000466235 ; RUVBL2-001; intron 1
OTTHUMT00000466236 ; RUVBL2-002; intron 1
OTTHUMT00000466237 ; RUVBL2-007; intron 1
OTTHUMT00000466239 ; RUVBL2-003; intron 1
OTTHUMT00000466241 ; RUVBL2-005; intron 1
OTTHUMT00000466242 ; RUVBL2-006; intron 1
OTTHUMT00000466243 ; RUVBL2-008; intron 1
OTTHUMT00000466240 ; RUVBL2-011; intron 2
OTTHUMT00000466238 ; RUVBL2-010; intron 3
ENST00000595090 ; RUVBL2-001; intron 1
ENST00000601968 ; RUVBL2-002; intron 1
ENST00000596837 ; RUVBL2-007; intron 1
ENST00000594017 ; RUVBL2-003; intron 1
ENST00000596247 ; RUVBL2-005; intron 1
ENST00000221413 ; RUVBL2-006; intron 1
ENST00000593570 ; RUVBL2-008; intron 1
ENST00000413176 ; RUVBL2-201; intron 1
ENST00000598768 ; RUVBL2-011; intron 2
ENST00000595811 ; RUVBL2-010; intron 3
Database links

Mature sequence hsa-miR-150-5p

Accession MIMAT0000451
Previous IDshsa-miR-150
Sequence

16 - 

ucucccaacccuuguaccagug

 - 37

Get sequence
Deep sequencing117587 reads, 137 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-150-3p

Accession MIMAT0004610
Previous IDshsa-miR-150*
Sequence

51 - 

cugguacaggccugggggacag

 - 72

Get sequence
Deep sequencing5567 reads, 83 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).