Stem-loop sequence hsa-mir-149

AccessionMI0000478
Symbol HGNC:MIR149
DescriptionHomo sapiens miR-149 stem-loop
Gene family MIPF0000274; mir-149
Stem-loop
   g     -    g   u u g      g     a     g g   g 
5'  ccggc gccc agc c g cuccgu ucuuc cuccc u cuu u
    ||||| |||| ||| | | |||||| ||||| ||||| | |||  
3'  ggucg cggg ucg g c ggggca ggagg gaggg a gag c
   a     a    g   u u g      g     -     - g   c 
Get sequence
Deep sequencing
20431 reads, 913 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr2: 240456001-240456089 [+]
intergenic
Database links

Mature sequence hsa-miR-149-5p

Accession MIMAT0000450
Previous IDshsa-miR-149
Sequence

15 - 

ucuggcuccgugucuucacuccc

 - 37

Get sequence
Deep sequencing504 reads, 43 experiments
Evidence experimental; cloned [2-3]
Predicted targets

Mature sequence hsa-miR-149-3p

Accession MIMAT0004609
Previous IDshsa-miR-149*
Sequence

56 - 

agggagggacgggggcugugc

 - 76

Get sequence
Deep sequencing28 reads, 7 experiments
Evidence experimental; cloned [3]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).