Stem-loop sequence hsa-mir-146a

AccessionMI0000477
Previous IDshsa-mir-146
Symbol HGNC:MIR146A
DescriptionHomo sapiens miR-146a stem-loop
Gene family MIPF0000103; mir-146
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c     -----u      u     uu            c  u     g  uc 
5'  cgaug      guaucc cagcu  gagaacugaauu ca ggguu ug  a
    |||||      |||||| |||||  |||||||||||| || ||||| ||  g
3'  gcuac      uauagg gucga  uucuugacuuaa gu uccag ac  u
   u     ugucuc      -     -c            a  c     -  ug 
Get sequence
Deep sequencing
92116 reads, 6.67e+03 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr5: 160485352-160485450 [+]
intergenic
Database links

Mature sequence hsa-miR-146a-5p

Accession MIMAT0000449
Previous IDshsa-miR-146;hsa-miR-146a
Sequence

21 - 

ugagaacugaauuccauggguu

 - 42

Get sequence
Deep sequencing31854 reads, 55 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-146a-3p

Accession MIMAT0004608
Previous IDshsa-miR-146a*
Sequence

57 - 

ccucugaaauucaguucuucag

 - 78

Get sequence
Deep sequencing181 reads, 12 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).