Stem-loop sequence hsa-mir-146a

AccessionMI0000477 (change log)
Previous IDshsa-mir-146
Symbol HGNC:MIR146A
DescriptionHomo sapiens miR-146a stem-loop
Gene family MIPF0000103; mir-146
Literature search

749 open access papers mention hsa-mir-146a
(6672 sentences)

Stem-loop
   c     -----u      u     uu            c  u     g  uc 
5'  cgaug      guaucc cagcu  gagaacugaauu ca ggguu ug  a
    |||||      |||||| |||||  |||||||||||| || ||||| ||  g
3'  gcuac      uauagg gucga  uucuugacuuaa gu uccag ac  u
   u     ugucuc      -     -c            a  c     -  ug 
Get sequence
Deep sequencing
1355616 reads, 2.37e+03 reads per million, 160 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 160485352-160485450 [+]
intergenic
Database links

Mature sequence hsa-miR-146a-5p

Accession MIMAT0000449
Previous IDshsa-miR-146;hsa-miR-146a
Sequence

21 - 

ugagaacugaauuccauggguu

 - 42

Get sequence
Deep sequencing1354966 reads, 160 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-146a-3p

Accession MIMAT0004608
Previous IDshsa-miR-146a*
Sequence

57 - 

ccucugaaauucaguucuucag

 - 78

Get sequence
Deep sequencing599 reads, 79 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).