Stem-loop sequence hsa-mir-138-1

Accession MI0000476
Symbol HGNC:MIR138-1
Description Homo sapiens miR-138-1 stem-loop
Gene family MIPF0000075; mir-138
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-138. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-138 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-138 precursor is the microRNA mir-138. miR-138 has been used as an example of the post-transcriptional regulation of miRNA, due to the finding that while the precursor is expressed ubiquitously, the mature product is found only in specific cell types.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c    gca          g   ag             uca       gc a 
 ccug   ugguguggug ggc  cugguguugugaa   ggccguu  c a
 ||||   |||||||||| |||  |||||||||||||   |||||||  | u
 ggac   aucacaccac ccg  gaccacaacacuu   ucggcaa  g c
-    ---          a   -g             -ca       ga a 
Get sequence
Deep sequencing
2742 reads, 25 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Expression in human was later validated by cloning [2,3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 44155704-44155802 [+]
intergenic
Database links

Mature sequence hsa-miR-138-5p

Accession MIMAT0000430
Previous IDs hsa-miR-138
Sequence

23 - 

agcugguguugugaaucaggccg

 - 45

Get sequence
Deep sequencing 2690 reads, 24 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-138-1-3p

Accession MIMAT0004607
Previous IDs hsa-miR-138-1*
Sequence

63 - 

gcuacuucacaacaccagggcc

 - 84

Get sequence
Deep sequencing 44 reads, 10 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).