Stem-loop sequence hsa-mir-138-1

AccessionMI0000476 (change log)
Symbol HGNC:MIR138-1
DescriptionHomo sapiens miR-138-1 stem-loop
Gene family MIPF0000075; mir-138
Literature search

228 open access papers mention hsa-mir-138-1
(1551 sentences)

Stem-loop
   c    gca          g   ag             uca       gc a 
5'  ccug   ugguguggug ggc  cugguguugugaa   ggccguu  c a
    ||||   |||||||||| |||  |||||||||||||   |||||||  | u
3'  ggac   aucacaccac ccg  gaccacaacacuu   ucggcaa  g c
   -    ---          a   -g             -ca       ga a 
Get sequence
Deep sequencing
103160 reads, 180 reads per million, 138 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Expression in human was later validated by cloning [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 44114212-44114310 [+]
intergenic
Database links

Mature sequence hsa-miR-138-5p

Accession MIMAT0000430
Previous IDshsa-miR-138
Sequence

23 - 

agcugguguugugaaucaggccg

 - 45

Get sequence
Deep sequencing176706 reads, 139 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-138-1-3p

Accession MIMAT0004607
Previous IDshsa-miR-138-1*
Sequence

63 - 

gcuacuucacaacaccagggcc

 - 84

Get sequence
Deep sequencing14300 reads, 73 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).