Stem-loop sequence hsa-mir-136

AccessionMI0000475
Symbol HGNC:MIR136
DescriptionHomo sapiens miR-136 stem-loop
Gene family MIPF0000099; mir-136
Stem-loop
   u        g        c     uuu          uuc 
5'  gagcccuc gaggacuc auuug   ugaugaugga   u
    |||||||| |||||||| |||||   ||||||||||   u
3'  cuugggag cuucugag uaaac   gcuacuaccu   a
   u        a        -     ucu          cgu 
Get sequence
Deep sequencing
2852 reads, 1.04e+03 reads per million, 48 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-136 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 100884702-100884783 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-136
hsa-mir-665chr14: 100875033-100875104 [+]
hsa-mir-431chr14: 100881007-100881120 [+]
hsa-mir-433chr14: 100881886-100881978 [+]
hsa-mir-127chr14: 100882979-100883075 [+]
hsa-mir-432chr14: 100884483-100884576 [+]
hsa-mir-136chr14: 100884702-100884783 [+]
Database links

Mature sequence hsa-miR-136-5p

Accession MIMAT0000448
Previous IDshsa-miR-136
Sequence

15 - 

acuccauuuguuuugaugaugga

 - 37

Get sequence
Deep sequencing573 reads, 39 experiments
Evidence experimental; cloned [2-4]
Predicted targets

Mature sequence hsa-miR-136-3p

Accession MIMAT0004606
Previous IDshsa-miR-136*
Sequence

49 - 

caucaucgucucaaaugagucu

 - 70

Get sequence
Deep sequencing250 reads, 34 experiments
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).