Stem-loop sequence hsa-mir-134

Accession

MI0000474

Symbol

HGNC:MIR134

Description

Homo sapiens miR-134 stem-loop

Gene family

MIPF0000112; mir-134

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-134. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-134 is a family of microRNA precursors found in mammals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-134 precursor is the microRNA mir-134. miR-134 was one of a number of microRNAs found to be increasingly expressed in schizophrenia.

Stem-loop

c     gu        u  -a   g    ---    g 
 agggu  gugacugg ug  cca aggg   gcau c
 |||||  |||||||| ||  ||| ||||   |||| a
 uccca  cacugauc ac  ggu uccc   ugug c
c     ac        c  cg   g    acu    u 

Deep sequencing

1587 reads, 19 experiments

Comments

miR-134 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCh37.p5): chr14: 101521024-101521096 [+]
• Overlapping transcripts:

  sense

  ENST00000385258 ; MIR134-201; exon 1

Clustered miRNAs

< 10kb from hsa-mir-134

• hsa-mir-381: chr14: 101512257-101512331 [+]
• hsa-mir-487b: chr14: 101512792-101512875 [+]
• hsa-mir-539: chr14: 101513658-101513735 [+]
• hsa-mir-889: chr14: 101514238-101514316 [+]
• hsa-mir-544a: chr14: 101514995-101515085 [+]
• hsa-mir-655: chr14: 101515887-101515983 [+]
• hsa-mir-487a: chr14: 101518783-101518862 [+]
• hsa-mir-382: chr14: 101520643-101520718 [+]
• hsa-mir-134: chr14: 101521024-101521096 [+]
• hsa-mir-668: chr14: 101521595-101521660 [+]
• hsa-mir-485: chr14: 101521756-101521828 [+]
• hsa-mir-323b: chr14: 101522556-101522637 [+]
• hsa-mir-154: chr14: 101526092-101526175 [+]
• hsa-mir-496: chr14: 101526910-101527011 [+]
• hsa-mir-377: chr14: 101528387-101528455 [+]
• hsa-mir-541: chr14: 101530832-101530915 [+]

Database links

• ENTREZGENE: 406924;MIR134
• HGNC: 31519;MIR134

Mature sequence hsa-miR-134

• Accession: MIMAT0000447
• Sequence: 8 - ugugacugguugaccagagggg - 29
• Deep sequencing: 1579 reads, 15 experiments
• Evidence: experimental; cloned [2-4]
• Validated targets:
  • MIRTARBASE:hsa-miR-134
  • TARBASE:hsa-miR-134
• Predicted targets:
  • DIANA-MICROT:hsa-miR-134
  • MICRORNA.ORG:hsa-miR-134
  • MIRDB:hsa-miR-134
  • RNA22-HSA:hsa-miR-134
  • TARGETMINER:hsa-miR-134
  • TARGETSCAN-VERT:hsa-miR-134
  • PICTAR-VERT:hsa-miR-134

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).