Stem-loop sequence hsa-mir-134

AccessionMI0000474 (change log)
Symbol HGNC:MIR134
DescriptionHomo sapiens miR-134 stem-loop
Gene family MIPF0000112; mir-134
Literature search

151 open access papers mention hsa-mir-134
(800 sentences)

Stem-loop
   c     gu        u  -a   g    ---    g 
5'  agggu  gugacugg ug  cca aggg   gcau c
    |||||  |||||||| ||  ||| ||||   |||| a
3'  uccca  cacugauc ac  ggu uccc   ugug c
   c     ac        c  cg   g    acu    u 
Get sequence
Deep sequencing
55185 reads, 119 reads per million, 133 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-134 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101054687-101054759 [+]
antisense
OTTHUMT00000414339 ; CTD-2644I21.1-001; intron 1
ENST00000554540 ; CTD-2644I21.1-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-134
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
hsa-mir-154chr14: 101059755-101059838 [+]
hsa-mir-496chr14: 101060573-101060674 [+]
hsa-mir-377chr14: 101062050-101062118 [+]
hsa-mir-541chr14: 101064495-101064578 [+]
Database links

Mature sequence hsa-miR-134-5p

Accession MIMAT0000447
Sequence

8 - 

ugugacugguugaccagagggg

 - 29

Get sequence
Deep sequencing54980 reads, 129 experiments
Evidence experimental; cloned [2-4], Illumina [5]
Database links
Predicted targets

Mature sequence hsa-miR-134-3p

Accession MIMAT0026481
Sequence

46 - 

ccugugggccaccuagucaccaa

 - 68

Get sequence
Deep sequencing199 reads, 65 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).