Stem-loop sequence hsa-mir-129-2

Accession MI0000473
Previous IDs hsa-mir-129b
Symbol HGNC:MIR129-2
Description Homo sapiens miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-129_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-129 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. This microRNA was first experimentally characterised in mouse and homologues have since been discovered in several other species, such as humans, rats and zebrafish. The mature sequence is excised by the Dicer enzyme from the 5' arm of the hairpin. It was elucidated by Calin et al. that miR-129-1 is located in a fragile site region of the human genome near a specific site, FRA7H in chromosome 7q32, which is a site commonly deleted in many cancers. miR-129-2 is located in 11p11.2.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u             -       c   cu      ---     acau 
 gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
 ||||||||||||| ||||||| |||  ||||||   |||||     
 cgggaggcguuua gaaaaac cca  cccgaa   cgaua    a
g             c       c   uu      ggc     acuc 
Get sequence
Deep sequencing
4520 reads, 29 experiments
Comments

This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MI0000252 ) and mouse (MI0000222 and MI0000585 ). Landgraf et al. show that the 5' product of mir-129-1 (MI0000222 ) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (this entry) [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 43602944-43603033 [+]
sense
OTTHUMT00000389684 ; HSD17B12-009; intron 1
OTTHUMT00000389685 ; HSD17B12-010; intron 1
OTTHUMT00000389684 ; HSD17B12-009; intron 1
OTTHUMT00000389685 ; HSD17B12-010; intron 1
OTTHUMT00000389684 ; HSD17B12-009; intron 1
OTTHUMT00000389685 ; HSD17B12-010; intron 1
OTTHUMT00000389683 ; HSD17B12-008; intron 2
OTTHUMT00000389683 ; HSD17B12-008; intron 2
OTTHUMT00000389683 ; HSD17B12-008; intron 2
ENST00000532864 ; HSD17B12-009; intron 1
ENST00000533358 ; HSD17B12-010; intron 1
ENST00000532864 ; HSD17B12-009; intron 1
ENST00000533358 ; HSD17B12-010; intron 1
ENST00000532864 ; HSD17B12-009; intron 1
ENST00000533358 ; HSD17B12-010; intron 1
ENST00000526615 ; HSD17B12-008; intron 2
ENST00000526615 ; HSD17B12-008; intron 2
ENST00000526615 ; HSD17B12-008; intron 2
Database links

Mature sequence hsa-miR-129-5p

Accession MIMAT0000242
Previous IDs hsa-miR-129
Sequence

15 - 

cuuuuugcggucugggcuugc

 - 35

Get sequence
Deep sequencing 1896 reads, 21 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-129-2-3p

Accession MIMAT0004605
Previous IDs hsa-miR-129-3p
Sequence

57 - 

aagcccuuaccccaaaaagcau

 - 78

Get sequence
Deep sequencing 2622 reads, 20 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).