Stem-loop sequence hsa-mir-129-2

AccessionMI0000473 (change log)
Previous IDshsa-mir-129b
Symbol HGNC:MIR129-2
DescriptionHomo sapiens miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Literature search

136 open access papers mention hsa-mir-129-2
(1222 sentences)

Stem-loop
   u             -       c   cu      ---     acau 
5'  gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
    ||||||||||||| ||||||| |||  ||||||   |||||     
3'  cgggaggcguuua gaaaaac cca  cccgaa   cgaua    a
   g             c       c   uu      ggc     acuc 
Get sequence
Deep sequencing
82435 reads, 68.6 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA cloned from mouse cerebellum [1]. Expression of this miRNA was subsequently verified in a human osteoblast sarcoma cell line [2]. Reference [2] named the human/mouse conserved sequence miR-129b, but subsequent genome searches suggest that the same mature sequence may be expressed from two predicted hairpin precursors in both human (this entry and MI0000252) and mouse (MI0000222 and MI0000585). Landgraf et al. show that the 5' product of mir-129-1 (MI0000222) is the predominant one, whereas both 5' and 3' products are significantly expressed from mir-129-2 (this entry) [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 43581394-43581483 [+]
sense
OTTHUMT00000337474 ; AC023085.1-001; intron 1
OTTHUMT00000389683 ; HSD17B12-008; intron 2
ENST00000446181 ; MIR670HG-001; intron 1
ENST00000526615 ; HSD17B12-008; intron 2
Database links

Mature sequence hsa-miR-129-5p

Accession MIMAT0000242
Previous IDshsa-miR-129
Sequence

15 - 

cuuuuugcggucugggcuugc

 - 35

Get sequence
Deep sequencing127090 reads, 146 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-129-2-3p

Accession MIMAT0004605
Previous IDshsa-miR-129-3p
Sequence

57 - 

aagcccuuaccccaaaaagcau

 - 78

Get sequence
Deep sequencing18883 reads, 136 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).