Stem-loop sequence hsa-mir-127

Accession MI0000472
Symbol HGNC:MIR127
Description Homo sapiens miR-127 stem-loop
Gene family MIPF0000080; mir-127
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-127. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-127 microRNA is a short non-coding RNA molecule with interesting overlapping gene structure. miR-127 functions to regulate the expression levels of genes involved in lung development, placental formation and apoptosis. Aberrant expression of miR-127 has been linked to different cancers.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
-----  u   ca   ucu      ugcug         g  c      --  a 
     ug gau  cug   ccagcc     aagcucaga gg ucugau  uc g
     || |||  |||   ||||||     ||||||||| || ||||||  || a
     ac cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
cuacu  u   aa   --u      -----         g  u      cu  a 
Get sequence
Deep sequencing
5645 reads, 5 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed by cloning in human cells [2,3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 101349316-101349412 [+]
antisense
OTTHUMT00000395127 ; RTL1-001; exon 1
OTTHUMT00000395127 ; RTL1-001; exon 1
OTTHUMT00000395127 ; RTL1-001; exon 1
ENST00000534062 ; RTL1-001; exon 1
ENST00000534062 ; RTL1-001; exon 1
ENST00000534062 ; RTL1-001; exon 1
Clustered miRNAs
< 10kb from hsa-mir-127
hsa-mir-337 chr14: 101340830-101340922 [+]
hsa-mir-665 chr14: 101341370-101341441 [+]
hsa-mir-431 chr14: 101347344-101347457 [+]
hsa-mir-433 chr14: 101348223-101348315 [+]
hsa-mir-127 chr14: 101349316-101349412 [+]
hsa-mir-432 chr14: 101350820-101350913 [+]
hsa-mir-136 chr14: 101351039-101351120 [+]
Database links

Mature sequence hsa-miR-127-5p

Accession MIMAT0004604
Sequence

23 - 

cugaagcucagagggcucugau

 - 44

Get sequence
Deep sequencing 198 reads, 1 experiments
Evidence experimental; cloned [3-4]
Predicted targets

Mature sequence hsa-miR-127-3p

Accession MIMAT0000446
Previous IDs hsa-miR-127
Sequence

57 - 

ucggauccgucugagcuuggcu

 - 78

Get sequence
Deep sequencing 5446 reads, 4 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).