Stem-loop sequence hsa-mir-127

AccessionMI0000472 (change log)
Symbol HGNC:MIR127
DescriptionHomo sapiens miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

154 open access papers mention hsa-mir-127
(919 sentences)

Stem-loop
   -----  u   ca   ucu      ugcug         g  c      --  a 
5'      ug gau  cug   ccagcc     aagcucaga gg ucugau  uc g
        || |||  |||   ||||||     ||||||||| || ||||||  || a
3'      ac cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
   cuacu  u   aa   --u      -----         g  u      cu  a 
Get sequence
Deep sequencing
220520 reads, 396 reads per million, 134 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed by cloning in human cells [2,3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100882979-100883075 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-127
hsa-mir-337chr14: 100874493-100874585 [+]
hsa-mir-665chr14: 100875033-100875104 [+]
hsa-mir-431chr14: 100881007-100881120 [+]
hsa-mir-433chr14: 100881886-100881978 [+]
hsa-mir-127chr14: 100882979-100883075 [+]
hsa-mir-432chr14: 100884483-100884576 [+]
hsa-mir-136chr14: 100884702-100884783 [+]
Database links

Mature sequence hsa-miR-127-5p

Accession MIMAT0004604
Sequence

23 - 

cugaagcucagagggcucugau

 - 44

Get sequence
Deep sequencing13044 reads, 118 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

Mature sequence hsa-miR-127-3p

Accession MIMAT0000446
Previous IDshsa-miR-127
Sequence

57 - 

ucggauccgucugagcuuggcu

 - 78

Get sequence
Deep sequencing207374 reads, 133 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).