Stem-loop sequence hsa-mir-126

AccessionMI0000471 (change log)
Symbol HGNC:MIR126
DescriptionHomo sapiens miR-126 stem-loop
Gene family MIPF0000115; mir-126
Literature search

445 open access papers mention hsa-mir-126
(2732 sentences)

Stem-loop
   c    gc     - a           u       c cug   c 
5'  gcug  gacgg g cauuauuacuu ugguacg g   uga a
    ||||  ||||| | ||||||||||| ||||||| |   |||  
3'  cggc  cugcc c guaauaaugag gccaugc c   acu c
   a    ac     g -           u       u -aa   u 
Get sequence
Deep sequencing
1691116 reads, 4.48e+03 reads per million, 158 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 136670602-136670686 [+]
antisense
OTTHUMT00000054941 ; VAV2-003; intron 8
OTTHUMT00000054940 ; VAV2-002; intron 8
OTTHUMT00000054939 ; VAV2-001; intron 9
ENST00000406606 ; VAV2-003; intron 8
ENST00000371851 ; VAV2-002; intron 8
ENST00000371850 ; VAV2-001; intron 9
Database links

Mature sequence hsa-miR-126-5p

Accession MIMAT0000444
Previous IDshsa-miR-126*
Sequence

15 - 

cauuauuacuuuugguacgcg

 - 35

Get sequence
Deep sequencing501451 reads, 158 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-126-3p

Accession MIMAT0000445
Previous IDshsa-miR-126
Sequence

52 - 

ucguaccgugaguaauaaugcg

 - 73

Get sequence
Deep sequencing1189609 reads, 157 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).