Stem-loop sequence hsa-mir-125b-2

Accession MI0000470
Symbol HGNC:MIR125B2
Description Homo sapiens miR-125b-2 stem-loop
Gene family MIPF0000017; mir-125
Stem-loop 
a  aga   uu     uc  ug   c   a        -gg   u 
 cc   cuu  ccuag  cc  aga ccu acuuguga   uau u
 ||   |||  |||||  ||  ||| ||| ||||||||   |||  
 gg   gag  ggauc  gg  ucu gga ugaacacu   aug u
a  --g   gc     ca  gu   c   c        aca   a
Get sequence
Deep sequencing
11927 reads, 45 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr21: 17962557-17962645 [+]
sense
OTTHUMT00000158031 ; C21orf34-003; intron 1
OTTHUMT00000158031 ; C21orf34-003; intron 1
OTTHUMT00000158031 ; C21orf34-003; intron 1
OTTHUMT00000158035 ; C21orf34-007; intron 3
OTTHUMT00000158037 ; C21orf34-009; intron 3
OTTHUMT00000158038 ; C21orf34-010; intron 3
OTTHUMT00000158035 ; C21orf34-007; intron 3
OTTHUMT00000158037 ; C21orf34-009; intron 3
OTTHUMT00000158038 ; C21orf34-010; intron 3
OTTHUMT00000158035 ; C21orf34-007; intron 3
OTTHUMT00000158037 ; C21orf34-009; intron 3
OTTHUMT00000158038 ; C21orf34-010; intron 3
OTTHUMT00000158032 ; C21orf34-004; intron 5
OTTHUMT00000158034 ; C21orf34-006; intron 5
OTTHUMT00000158032 ; C21orf34-004; intron 5
OTTHUMT00000158034 ; C21orf34-006; intron 5
OTTHUMT00000158032 ; C21orf34-004; intron 5
OTTHUMT00000158034 ; C21orf34-006; intron 5
OTTHUMT00000158029 ; C21orf34-001; intron 6
OTTHUMT00000158030 ; C21orf34-002; intron 6
OTTHUMT00000158029 ; C21orf34-001; intron 6
OTTHUMT00000158030 ; C21orf34-002; intron 6
OTTHUMT00000158029 ; C21orf34-001; intron 6
OTTHUMT00000158030 ; C21orf34-002; intron 6
ENST00000441820 ; C21orf34-003; intron 1
ENST00000441820 ; LINC00478-003; intron 1
ENST00000441820 ; LINC00478-003; intron 1
ENST00000428669 ; C21orf34-007; intron 3
ENST00000453910 ; C21orf34-009; intron 3
ENST00000418813 ; C21orf34-010; intron 3
ENST00000428669 ; LINC00478-007; intron 3
ENST00000453910 ; LINC00478-009; intron 3
ENST00000418813 ; LINC00478-010; intron 3
ENST00000428669 ; LINC00478-007; intron 3
ENST00000453910 ; LINC00478-009; intron 3
ENST00000418813 ; LINC00478-010; intron 3
ENST00000400178 ; C21orf34-004; intron 5
ENST00000445461 ; C21orf34-006; intron 5
ENST00000400178 ; LINC00478-004; intron 5
ENST00000445461 ; LINC00478-006; intron 5
ENST00000400178 ; LINC00478-004; intron 5
ENST00000445461 ; LINC00478-006; intron 5
ENST00000458468 ; C21orf34-001; intron 6
ENST00000456342 ; C21orf34-002; intron 6
ENST00000458468 ; LINC00478-001; intron 6
ENST00000456342 ; LINC00478-002; intron 6
ENST00000458468 ; LINC00478-001; intron 6
ENST00000456342 ; LINC00478-002; intron 6
Database links

Mature sequence hsa-miR-125b-5p

Accession MIMAT0000423
Previous IDs hsa-miR-125b
Sequence

17 -  

ucccugagacccuaacuuguga

 - 38

Get sequence
Deep sequencing 23617 reads, 38 experiments
Evidence experimental; cloned [2,4-6], Solexa [7]
Validated targets
Predicted targets

Mature sequence hsa-miR-125b-2-3p

Accession MIMAT0004603
Previous IDs hsa-miR-125b-2*
Sequence

54 -  

ucacaagucaggcucuugggac

 - 75

Get sequence
Deep sequencing 90 reads, 18 experiments
Evidence experimental; cloned [5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
PMID:15722555 "Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation" Lee YS, Kim HK, Chung S, Kim KS, Dutta A J Biol Chem. 280:16635-16641(2005).
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7
PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).