Stem-loop sequence hsa-mir-125b-2

AccessionMI0000470
Symbol HGNC:MIR125B2
DescriptionHomo sapiens miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   a  aga   uu     uc  ug   c   a        -gg   u 
5'  cc   cuu  ccuag  cc  aga ccu acuuguga   uau u
    ||   |||  |||||  ||  ||| ||| ||||||||   |||  
3'  gg   gag  ggauc  gg  ucu gga ugaacacu   aug u
   a  --g   gc     ca  gu   c   c        aca   a 
Get sequence
Deep sequencing
30161 reads, 7.32e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human BC-1 cells [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr21: 16590237-16590325 [+]
intergenic
Database links

Mature sequence hsa-miR-125b-5p

Accession MIMAT0000423
Previous IDshsa-miR-125b
Sequence

17 - 

ucccugagacccuaacuuguga

 - 38

Get sequence
Deep sequencing3139 reads, 48 experiments
Evidence experimental; cloned [2,4-6], Illumina [7]
Validated targets
Predicted targets

Mature sequence hsa-miR-125b-2-3p

Accession MIMAT0004603
Previous IDshsa-miR-125b-2*
Sequence

54 - 

ucacaagucaggcucuugggac

 - 75

Get sequence
Deep sequencing357 reads, 41 experiments
Evidence experimental; cloned [5]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
4
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
5
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
6
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
7