Stem-loop sequence hsa-mir-125a

AccessionMI0000469
Symbol HGNC:MIR125A
DescriptionHomo sapiens miR-125a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   u     u u     uc  ug   c    ua        ----  a 
5'  gccag c cuagg  cc  aga ccuu  accuguga    gg c
    ||||| | |||||  ||  ||| ||||  ||||||||    ||  
3'  cgguc g ggucc  gg  ucu ggag  uggacacu    cc a
   c     u c     ga  gu   u    --        ggga  u 
Get sequence
Deep sequencing
51435 reads, 4.02e+03 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 51693254-51693339 [+]
sense
OTTHUMT00000465190 ; SIGLEC20P-001; intron 6
ENST00000595243 ; SIGLEC20P-001; intron 6
Clustered miRNAs
< 10kb from hsa-mir-125a
hsa-mir-99bchr19: 51692612-51692681 [+]
hsa-let-7echr19: 51692786-51692864 [+]
hsa-mir-125achr19: 51693254-51693339 [+]
Database links

Mature sequence hsa-miR-125a-5p

Accession MIMAT0000443
Previous IDshsa-miR-125a
Sequence

15 - 

ucccugagacccuuuaaccuguga

 - 38

Get sequence
Deep sequencing1415 reads, 60 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-125a-3p

Accession MIMAT0004602
Sequence

53 - 

acaggugagguucuugggagcc

 - 74

Get sequence
Deep sequencing384 reads, 39 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).