Stem-loop sequence hsa-mir-9-3

Accession MI0000468
Symbol HGNC:MIR9-3
Description Homo sapiens miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-9/mir-79_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-9 microRNA (homologous to miR-79), is a short non-coding RNA gene involved in gene regulation. The mature ~21nt miRNAs are processed from hairpin precursor sequences by the Dicer enzyme. The dominant mature miRNA sequence is processed from the 5' arm of the mir-9 precursor, and from the 3' arm of the mir-79 precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In vertebrates, miR-9 is highly expressed in the brain, and is suggested to regulate neuronal differentiation. A number of specific targets of miR-9 have been proposed, including the transcription factor REST and its partner CoREST.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g    cc       -  c               g     gu  ca 
 gagg  cguuucu cu uuugguuaucuagcu uauga  gc  c
 ||||  ||||||| || ||||||||||||||| |||||  ||   
 cucu  guaaaga ga aagccaauagaucga auacu  cg  a
a    ua       u  -               a     gc  ag 
Get sequence
Deep sequencing
3392 reads, 34 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr15: 89911248-89911337 [+]
sense
OTTHUMT00000416278 ; CTD-2335A18.1-001; intron 1
OTTHUMT00000416279 ; CTD-2335A18.1-006; intron 1
OTTHUMT00000416280 ; CTD-2335A18.1-007; intron 1
OTTHUMT00000416278 ; CTD-2335A18.1-001; intron 1
OTTHUMT00000416279 ; CTD-2335A18.1-006; intron 1
OTTHUMT00000416280 ; CTD-2335A18.1-007; intron 1
ENST00000536780 ; AC133637.1-201; intron 1
ENST00000536780 ; CTD-2335A18.1-001; intron 1
ENST00000560008 ; CTD-2335A18.1-006; intron 1
ENST00000561327 ; CTD-2335A18.1-007; intron 1
ENST00000536780 ; CTD-2335A18.1-001; intron 1
ENST00000560008 ; CTD-2335A18.1-006; intron 1
ENST00000561327 ; CTD-2335A18.1-007; intron 1
Database links

Mature sequence hsa-miR-9-5p

Accession MIMAT0000441
Previous IDs hsa-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing 8411 reads, 32 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-9-3p

Accession MIMAT0000442
Previous IDs hsa-miR-9*
Sequence

55 - 

auaaagcuagauaaccgaaagu

 - 76

Get sequence
Deep sequencing 1592 reads, 21 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).