Stem-loop sequence hsa-mir-9-2

AccessionMI0000467 (change log)
Symbol HGNC:MIR9-2
DescriptionHomo sapiens miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Literature search

539 open access papers mention hsa-mir-9-2
(3299 sentences)

Stem-loop
   g    c     g   uc               g      ug a 
5'  gaag gaguu uua  uuugguuaucuagcu uaugag  u u
    |||| ||||| |||  ||||||||||||||| ||||||  |  
3'  cuuc cucaa aau  aagccaauagaucga auacuu  g u
   a    -     a   ga               a      cu g 
Get sequence
Deep sequencing
806754 reads, 1.07e+03 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 88666853-88666939 [-]
antisense
OTTHUMT00000369797 ; CTC-454M9.1-003; intron 4
ENST00000514092 ; MEF2C-AS1-003; intron 4
Database links

Mature sequence hsa-miR-9-5p

Accession MIMAT0000441
Previous IDshsa-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing2152514 reads, 151 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-9-3p

Accession MIMAT0000442
Previous IDshsa-miR-9*
Sequence

53 - 

auaaagcuagauaaccgaaagu

 - 74

Get sequence
Deep sequencing266091 reads, 137 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).