Stem-loop sequence hsa-mir-9-1

AccessionMI0000466 (change log)
Symbol HGNC:MIR9-1
DescriptionHomo sapiens miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

547 open access papers mention hsa-mir-9-1
(3315 sentences)

Stem-loop
   c       guug   uc               g      u  ug 
5'  gggguug    uua  uuugguuaucuagcu uaugag gg  u
    |||||||    |||  ||||||||||||||| |||||| ||  g
3'  ccccaau    aau  aagccaauagaucga auacuu cu  g
   a       -aaa   ga               a      -  ga 
Get sequence
Deep sequencing
806436 reads, 1.07e+03 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 156420341-156420429 [-]
sense
OTTHUMT00000080560 ; RP11-98G7.1-001; intron 3
ENST00000441085 ; RP11-98G7.1-001; intron 3
Database links

Mature sequence hsa-miR-9-5p

Accession MIMAT0000441
Previous IDshsa-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing2152514 reads, 151 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-9-3p

Accession MIMAT0000442
Previous IDshsa-miR-9*
Sequence

55 - 

auaaagcuagauaaccgaaagu

 - 76

Get sequence
Deep sequencing266091 reads, 137 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).