Stem-loop sequence hsa-mir-191

Accession

MI0000465

Symbol

HGNC:MIR191

Description

Homo sapiens miR-191 stem-loop

Gene family

MIPF0000194; mir-191

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-191. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-191 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-191 has been found to be dysregulated in a large number of different types of human tumour, including those of colorectal, breast and prostate cancers. Despite these cancer links, target genes of the mature miRNA have not been characterised, and it is not known which factors lead to its dysregulation in certain tumour cells. The expression profile of miR-191 could be implemented in prognosis of acute myeloid leukaemia, with higher than average levels of miR-191 suggesting a lower survival probability.

Stem-loop

c   u   c      ca         c  aa       uu  -  c 
 ggc gga agcggg  acggaaucc aa  gcagcug  gu cu c
 ||| ||| ||||||  ||||||||| ||  |||||||  || ||  
 ccg ccu ucgucc  ugcuuuagg uu  cgucgac  ua ga a
u   u   c      cc         -  cg       cu  c  g 

Deep sequencing

96889 reads, 47 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed in human HL-60 leukemia cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCh37.p5): chr3: 49058051-49058142 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000345586 ; DALRD3-007; intron 1

  OTTHUMT00000345587 ; DALRD3-008; intron 1

  OTTHUMT00000345595 ; DALRD3-016; intron 1

  OTTHUMT00000345596 ; DALRD3-017; intron 1

  OTTHUMT00000345586 ; DALRD3-007; intron 1

  OTTHUMT00000345587 ; DALRD3-008; intron 1

  OTTHUMT00000345595 ; DALRD3-016; intron 1

  OTTHUMT00000345596 ; DALRD3-017; intron 1

  OTTHUMT00000345586 ; DALRD3-007; intron 1

  OTTHUMT00000345587 ; DALRD3-008; intron 1

  OTTHUMT00000345595 ; DALRD3-016; intron 1

  OTTHUMT00000345596 ; DALRD3-017; intron 1

  ENST00000440857 ; DALRD3-007; intron 1

  ENST00000313778 ; DALRD3-008; intron 1

  ENST00000496568 ; DALRD3-016; intron 1

  ENST00000492585 ; DALRD3-017; intron 1

  ENST00000440857 ; DALRD3-007; intron 1

  ENST00000313778 ; DALRD3-008; intron 1

  ENST00000496568 ; DALRD3-016; intron 1

  ENST00000492585 ; DALRD3-017; intron 1

  ENST00000440857 ; DALRD3-007; intron 1

  ENST00000313778 ; DALRD3-008; intron 1

  ENST00000496568 ; DALRD3-016; intron 1

  ENST00000492585 ; DALRD3-017; intron 1

  antisense

  OTTHUMT00000345685 ; NDUFAF3-003; intron 1

  OTTHUMT00000345685 ; NDUFAF3-003; intron 1

  OTTHUMT00000345685 ; NDUFAF3-003; intron 1

  ENST00000326912 ; NDUFAF3-003; intron 1

  ENST00000326912 ; NDUFAF3-003; intron 1

  ENST00000326912 ; NDUFAF3-003; intron 1

Clustered miRNAs

< 10kb from hsa-mir-191

• hsa-mir-191: chr3: 49058051-49058142 [-]
• hsa-mir-425: chr3: 49057581-49057667 [-]

Database links

• ENTREZGENE: 406966;MIR191
• HGNC: 31561;MIR191

Mature sequence hsa-miR-191-5p

• Accession: MIMAT0000440
• Previous IDs: hsa-miR-191
• Sequence: 16 - caacggaaucccaaaagcagcug - 38
• Deep sequencing: 96854 reads, 44 experiments
• Evidence: experimental; cloned [2-5]
• Validated targets:
  • TARBASE:hsa-miR-191-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-191-5p
  • MICRORNA.ORG:hsa-miR-191-5p
  • MIRDB:hsa-miR-191-5p
  • RNA22-HSA:hsa-miR-191-5p
  • TARGETMINER:hsa-miR-191-5p
  • TARGETSCAN-VERT:hsa-miR-191
  • PICTAR-VERT:hsa-miR-191

Mature sequence hsa-miR-191-3p

• Accession: MIMAT0001618
• Previous IDs: hsa-miR-191*
• Sequence: 58 - gcugcgcuuggauuucgucccc - 79
• Deep sequencing: 35 reads, 12 experiments
• Evidence: experimental; cloned [2-4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-191-3p
  • MICRORNA.ORG:hsa-miR-191-3p
  • MIRDB:hsa-miR-191-3p
  • RNA22-HSA:hsa-miR-191-3p
  • TARGETMINER:hsa-miR-191-3p
  • PICTAR-VERT:hsa-miR-191

References

1. PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3. PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).