Stem-loop sequence hsa-mir-191

Accession MI0000465
Symbol HGNC:MIR191
Description Homo sapiens miR-191 stem-loop
Gene family MIPF0000194; mir-191
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-191. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-191 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-191 has been found to be dysregulated in a large number of different types of human tumour, including those of colorectal, breast and prostate cancers. Despite these cancer links, target genes of the mature miRNA have not been characterised, and it is not known which factors lead to its dysregulation in certain tumour cells. The expression profile of miR-191 could be implemented in prognosis of acute myeloid leukaemia, with higher than average levels of miR-191 suggesting a lower survival probability.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   u   c      ca         c  aa       uu  -  c 
 ggc gga agcggg  acggaaucc aa  gcagcug  gu cu c
 ||| ||| ||||||  ||||||||| ||  |||||||  || ||  
 ccg ccu ucgucc  ugcuuuagg uu  cgucgac  ua ga a
u   u   c      cc         -  cg       cu  c  g 
Get sequence
Deep sequencing
96889 reads, 47 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA was later confirmed in human HL-60 leukemia cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 49058051-49058142 [-]
sense
OTTHUMT00000345586 ; DALRD3-007; intron 1
OTTHUMT00000345587 ; DALRD3-008; intron 1
OTTHUMT00000345595 ; DALRD3-016; intron 1
OTTHUMT00000345596 ; DALRD3-017; intron 1
OTTHUMT00000345586 ; DALRD3-007; intron 1
OTTHUMT00000345587 ; DALRD3-008; intron 1
OTTHUMT00000345595 ; DALRD3-016; intron 1
OTTHUMT00000345596 ; DALRD3-017; intron 1
OTTHUMT00000345586 ; DALRD3-007; intron 1
OTTHUMT00000345587 ; DALRD3-008; intron 1
OTTHUMT00000345595 ; DALRD3-016; intron 1
OTTHUMT00000345596 ; DALRD3-017; intron 1
ENST00000440857 ; DALRD3-007; intron 1
ENST00000313778 ; DALRD3-008; intron 1
ENST00000496568 ; DALRD3-016; intron 1
ENST00000492585 ; DALRD3-017; intron 1
ENST00000440857 ; DALRD3-007; intron 1
ENST00000313778 ; DALRD3-008; intron 1
ENST00000496568 ; DALRD3-016; intron 1
ENST00000492585 ; DALRD3-017; intron 1
ENST00000440857 ; DALRD3-007; intron 1
ENST00000313778 ; DALRD3-008; intron 1
ENST00000496568 ; DALRD3-016; intron 1
ENST00000492585 ; DALRD3-017; intron 1
antisense
OTTHUMT00000345685 ; NDUFAF3-003; intron 1
OTTHUMT00000345685 ; NDUFAF3-003; intron 1
OTTHUMT00000345685 ; NDUFAF3-003; intron 1
ENST00000326912 ; NDUFAF3-003; intron 1
ENST00000326912 ; NDUFAF3-003; intron 1
ENST00000326912 ; NDUFAF3-003; intron 1
Clustered miRNAs
< 10kb from hsa-mir-191
hsa-mir-191 chr3: 49058051-49058142 [-]
hsa-mir-425 chr3: 49057581-49057667 [-]
Database links

Mature sequence hsa-miR-191-5p

Accession MIMAT0000440
Previous IDs hsa-miR-191
Sequence

16 - 

caacggaaucccaaaagcagcug

 - 38

Get sequence
Deep sequencing 96854 reads, 44 experiments
Evidence experimental; cloned [2-5]
Validated targets
Predicted targets

Mature sequence hsa-miR-191-3p

Accession MIMAT0001618
Previous IDs hsa-miR-191*
Sequence

58 - 

gcugcgcuuggauuucgucccc

 - 79

Get sequence
Deep sequencing 35 reads, 12 experiments
Evidence experimental; cloned [2-4]
Predicted targets

References

1
PMID:12554859 "New microRNAs from mouse and human" Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T RNA. 9:175-179(2003).
2
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
3
PMID:15891114 "Clustering and conservation patterns of human microRNAs" Altuvia Y, Landgraf P, Lithwick G, Elefant N, Pfeffer S, Aravin A, Brownstein MJ, Tuschl T, Margalit H Nucleic Acids Res. 33:2697-2706(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).