Stem-loop sequence hsa-mir-153-2

AccessionMI0000464
Symbol HGNC:MIR153-2
DescriptionHomo sapiens miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   a     gg      -             gu       -a  aa 
5'  gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
    |||||  |||||| |||||||||||||  |||||||  ||  a
3'  uguca  gguuac agugaaaacacug  acguuga  cg  u
   g     aa      u             au       cc  ag 
Get sequence
Deep sequencing
414 reads, 159 reads per million, 35 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr7: 157574336-157574422 [-]
sense
OTTHUMT00000327121 ; PTPRN2-003; intron 11
OTTHUMT00000327120 ; PTPRN2-002; intron 11
OTTHUMT00000353213 ; PTPRN2-004; intron 11
OTTHUMT00000353214 ; PTPRN2-005; intron 12
ENST00000389413 ; PTPRN2-003; intron 11
ENST00000409483 ; PTPRN2-002; intron 11
ENST00000389416 ; PTPRN2-004; intron 11
ENST00000389418 ; PTPRN2-005; intron 12
ENST00000404321 ; PTPRN2-201; intron 12
Database links

Mature sequence hsa-miR-153-5p

Accession MIMAT0026480
Sequence

15 - 

ucauuuuugugauguugcagcu

 - 36

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-153-3p

Accession MIMAT0000439
Sequence

53 - 

uugcauagucacaaaagugauc

 - 74

Get sequence
Deep sequencing293 reads, 27 experiments
Evidence experimental; cloned [2], Illumina [3]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).