Stem-loop sequence hsa-mir-153-2

Accession MI0000464
Symbol HGNC:MIR153-2
Description Homo sapiens miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop 
a     gg      -             gu       -a  aa 
 gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
 |||||  |||||| |||||||||||||  |||||||  ||  a
 uguca  gguuac agugaaaacacug  acguuga  cg  u
g     aa      u             au       cc  ag
Get sequence
Deep sequencing
4 reads, 2 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr7: 157367028-157367114 [-]
sense
OTTHUMT00000353213 ; PTPRN2-004; intron 18
OTTHUMT00000327120 ; PTPRN2-002; intron 18
OTTHUMT00000327121 ; PTPRN2-003; intron 18
OTTHUMT00000353213 ; PTPRN2-004; intron 18
OTTHUMT00000327120 ; PTPRN2-002; intron 18
OTTHUMT00000327121 ; PTPRN2-003; intron 18
OTTHUMT00000353213 ; PTPRN2-004; intron 18
OTTHUMT00000327120 ; PTPRN2-002; intron 18
OTTHUMT00000327121 ; PTPRN2-003; intron 18
OTTHUMT00000353214 ; PTPRN2-005; intron 19
OTTHUMT00000353214 ; PTPRN2-005; intron 19
OTTHUMT00000353214 ; PTPRN2-005; intron 19
ENST00000409483 ; PTPRN2-002; intron 18
ENST00000389413 ; PTPRN2-003; intron 18
ENST00000389416 ; PTPRN2-004; intron 18
ENST00000409483 ; PTPRN2-002; intron 18
ENST00000389413 ; PTPRN2-003; intron 18
ENST00000389416 ; PTPRN2-004; intron 18
ENST00000409483 ; PTPRN2-002; intron 18
ENST00000389413 ; PTPRN2-003; intron 18
ENST00000389416 ; PTPRN2-004; intron 18
ENST00000389418 ; PTPRN2-005; intron 19
ENST00000404321 ; PTPRN2-201; intron 19
ENST00000389418 ; PTPRN2-005; intron 19
ENST00000404321 ; PTPRN2-201; intron 19
ENST00000389418 ; PTPRN2-005; intron 19
ENST00000404321 ; PTPRN2-201; intron 19
Database links

Mature sequence hsa-miR-153

Accession MIMAT0000439
Sequence

53 -  

uugcauagucacaaaagugauc

 - 74

Get sequence
Deep sequencing 6 reads, 1 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).