Stem-loop sequence hsa-mir-153-1

Accession

MI0000463

Symbol

HGNC:MIR153-1

Description

Homo sapiens miR-153-1 stem-loop

Gene family

MIPF0000050; mir-153

Stem-loop

c     g         -             -c       --   au 
 ucaca cugccagug ucauuuuugugau  ugcagcu  agu  u
 ||||| ||||||||| |||||||||||||  |||||||  |||   
 ggugu gacgguuac agugaaaacacug  acguuga  uca  c
c     g         u             au       cc   cu 

Deep sequencing

3 reads, 1 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

• Coordinates (GRCh37.p5): chr2: 220158833-220158922 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000335560 ; PTPRN-020; intron 2

  OTTHUMT00000335560 ; PTPRN-020; intron 2

  OTTHUMT00000335560 ; PTPRN-020; intron 2

  OTTHUMT00000335559 ; PTPRN-019; intron 4

  OTTHUMT00000335559 ; PTPRN-019; intron 4

  OTTHUMT00000335559 ; PTPRN-019; intron 4

  OTTHUMT00000335546 ; PTPRN-006; intron 16

  OTTHUMT00000335546 ; PTPRN-006; intron 16

  OTTHUMT00000335546 ; PTPRN-006; intron 16

  OTTHUMT00000335543 ; PTPRN-003; intron 18

  OTTHUMT00000335543 ; PTPRN-003; intron 18

  OTTHUMT00000335543 ; PTPRN-003; intron 18

  OTTHUMT00000256819 ; PTPRN-001; intron 19

  OTTHUMT00000256819 ; PTPRN-001; intron 19

  OTTHUMT00000256819 ; PTPRN-001; intron 19

  OTTHUMT00000335545 ; PTPRN-005; intron 20

  OTTHUMT00000335545 ; PTPRN-005; intron 20

  OTTHUMT00000335545 ; PTPRN-005; intron 20

  ENST00000443981 ; PTPRN-020; intron 2

  ENST00000443981 ; PTPRN-020; intron 2

  ENST00000443981 ; PTPRN-020; intron 2

  ENST00000497977 ; PTPRN-019; intron 4

  ENST00000497977 ; PTPRN-019; intron 4

  ENST00000497977 ; PTPRN-019; intron 4

  ENST00000462351 ; PTPRN-006; intron 16

  ENST00000462351 ; PTPRN-006; intron 16

  ENST00000462351 ; PTPRN-006; intron 16

  ENST00000409251 ; PTPRN-003; intron 18

  ENST00000539342 ; PTPRN-203; intron 18

  ENST00000409251 ; PTPRN-003; intron 18

  ENST00000539342 ; PTPRN-203; intron 18

  ENST00000409251 ; PTPRN-003; intron 18

  ENST00000539342 ; PTPRN-202; intron 18

  ENST00000295718 ; PTPRN-001; intron 19

  ENST00000537666 ; PTPRN-202; intron 19

  ENST00000295718 ; PTPRN-001; intron 19

  ENST00000537666 ; PTPRN-202; intron 19

  ENST00000295718 ; PTPRN-001; intron 19

  ENST00000537666 ; PTPRN-201; intron 19

  ENST00000423636 ; PTPRN-005; intron 20

  ENST00000423636 ; PTPRN-005; intron 20

  ENST00000423636 ; PTPRN-005; intron 20

Database links

• ENTREZGENE: 406944;MIR153-1
• HGNC: 31539;MIR153-1

Mature sequence hsa-miR-153

• Accession: MIMAT0000439
• Sequence: 54 - uugcauagucacaaaagugauc - 75
• Deep sequencing: 6 reads, 1 experiments
• Evidence: experimental; cloned [2]
• Validated targets:
  • MIRECORDS:hsa-miR-153
  • MIRTARBASE:hsa-miR-153
  • TARBASE:hsa-miR-153
• Predicted targets:
  • DIANA-MICROT:hsa-miR-153
  • MICRORNA.ORG:hsa-miR-153
  • MIRDB:hsa-miR-153
  • RNA22-HSA:hsa-miR-153
  • TARGETMINER:hsa-miR-153
  • TARGETSCAN-VERT:hsa-miR-153
  • PICTAR-VERT:hsa-miR-153

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).