Stem-loop sequence hsa-mir-152

AccessionMI0000462
Symbol HGNC:MIR152
DescriptionHomo sapiens miR-152 stem-loop
Gene family MIPF0000056; mir-148
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u    cc  c              g  a    cc    cgg   c 
5'  gucc  cc ggcccagguucugu au cacu  gacu   gcu u
    ||||  || |||||||||||||| || ||||  ||||   |||  
3'  cagg  gg ccggguucaagaca ua guga  cuga   cga g
   c    aa  c              g  c    --    ---   g 
Get sequence
Deep sequencing
43689 reads, 1.62e+03 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 48037161-48037247 [-]
intergenic
Database links

Mature sequence hsa-miR-152-5p

Accession MIMAT0026479
Sequence

16 - 

agguucugugauacacuccgacu

 - 38

Get sequence
Deep sequencing9 reads, 3 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence hsa-miR-152-3p

Accession MIMAT0000438
Sequence

54 - 

ucagugcaugacagaacuugg

 - 74

Get sequence
Deep sequencing1234 reads, 51 experiments
Evidence experimental; cloned [2-3], Illumina [4-5]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).