Stem-loop sequence hsa-mir-152

AccessionMI0000462 (change log)
Symbol HGNC:MIR152
DescriptionHomo sapiens miR-152 stem-loop
Gene family MIPF0000056; mir-148
Literature search

146 open access papers mention hsa-mir-152
(876 sentences)

Stem-loop
   u    cc  c              g  a    cc    cgg   c 
5'  gucc  cc ggcccagguucugu au cacu  gacu   gcu u
    ||||  || |||||||||||||| || ||||  ||||   |||  
3'  cagg  gg ccggguucaagaca ua guga  cuga   cga g
   c    aa  c              g  c    --    ---   g 
Get sequence
Deep sequencing
1136270 reads, 2.31e+03 reads per million, 158 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 48037161-48037247 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-152
hsa-mir-152chr17: 48037161-48037247 [-]
hsa-mir-10226chr17: 48032882-48032951 [+]
Database links

Mature sequence hsa-miR-152-5p

Accession MIMAT0026479
Sequence

16 - 

agguucugugauacacuccgacu

 - 38

Get sequence
Deep sequencing441 reads, 87 experiments
Evidence experimental; Illumina [5]
Predicted targets

Mature sequence hsa-miR-152-3p

Accession MIMAT0000438
Sequence

54 - 

ucagugcaugacagaacuugg

 - 74

Get sequence
Deep sequencing1135823 reads, 158 experiments
Evidence experimental; cloned [2-3], Illumina [4-5]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).