Stem-loop sequence hsa-mir-152

Accession

MI0000462

Symbol

HGNC:MIR152

Description

Homo sapiens miR-152 stem-loop

Gene family

MIPF0000056; mir-148

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

u    cc  c              g  a    cc    cgg   c 
 gucc  cc ggcccagguucugu au cacu  gacu   gcu u
 ||||  || |||||||||||||| || ||||  ||||   |||  
 cagg  gg ccggguucaagaca ua guga  cuga   cga g
c    aa  c              g  c    --    ---   g 

Deep sequencing

78802 reads, 22 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

• Coordinates (GRCh37.p5): chr17: 46114527-46114613 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000442953 ; COPZ2-001; intron 1

  OTTHUMT00000442955 ; COPZ2-004; intron 1

  OTTHUMT00000442957 ; COPZ2-002; intron 1

  ENST00000584666 ; COPZ2-001; intron 1

  ENST00000582553 ; COPZ2-004; intron 1

  ENST00000580174 ; COPZ2-002; intron 1

  ENST00000006101 ; COPZ2-201; intron 2

  ENST00000006101 ; COPZ2-201; intron 2

  ENST00000006101 ; COPZ2-201; intron 2

Database links

• ENTREZGENE: 406943;MIR152
• HGNC: 31538;MIR152

Mature sequence hsa-miR-152

• Accession: MIMAT0000438
• Sequence: 54 - ucagugcaugacagaacuugg - 74
• Deep sequencing: 78797 reads, 21 experiments
• Evidence: experimental; cloned [2-3], Solexa [4]
• Validated targets:
  • MIRECORDS:hsa-miR-152
  • MIRTARBASE:hsa-miR-152
  • TARBASE:hsa-miR-152
• Predicted targets:
  • DIANA-MICROT:hsa-miR-152
  • MICRORNA.ORG:hsa-miR-152
  • MIRDB:hsa-miR-152
  • RNA22-HSA:hsa-miR-152
  • TARGETMINER:hsa-miR-152
  • TARGETSCAN-VERT:hsa-miR-152
  • PICTAR-VERT:hsa-miR-152

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
4. PMID:20158877 "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).