Stem-loop sequence hsa-mir-145

Accession MI0000461
Symbol HGNC:MIR145
Description Homo sapiens miR-145 stem-loop
Gene family MIPF0000079; mir-145
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-145. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-145 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   u  u     c  uc    u  c            uagau 
 acc ug ccuca gg  cagu uu ccaggaaucccu     g
 ||| || ||||| ||  |||| || ||||||||||||     c
 ugg ac ggagu uc  guca aa gguccuuagggg     u
u   u  u     -  uu    u  a            uagaa 
Get sequence
Deep sequencing
5746 reads, 41 experiments
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-145 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr5: 148810209-148810296 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-145
hsa-mir-143 chr5: 148808481-148808586 [+]
hsa-mir-145 chr5: 148810209-148810296 [+]
Database links

Mature sequence hsa-miR-145-5p

Accession MIMAT0000437
Previous IDs hsa-miR-145
Sequence

16 - 

guccaguuuucccaggaaucccu

 - 38

Get sequence
Deep sequencing 3996 reads, 40 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

Mature sequence hsa-miR-145-3p

Accession MIMAT0004601
Previous IDs hsa-miR-145*
Sequence

54 - 

ggauuccuggaaauacuguucu

 - 75

Get sequence
Deep sequencing 1699 reads, 21 experiments
Evidence experimental; cloned [4]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).