Stem-loop sequence MI0000461

Accession MI0000461
ID hsa-mir-145
Symbol HGNC:MIR145
Description Homo sapiens miR-145 stem-loop
Stem-loop 
c   u  u     c  uc    u  c            uagau 
 acc ug ccuca gg  cagu uu ccaggaaucccu     g
 ||| || ||||| ||  |||| || ||||||||||||     c
 ugg ac ggagu uc  guca aa gguccuuagggg     u
u   u  u     -  uu    u  a            uagaa
Get sequence
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-145 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh37) Overlapping transcripts
5: 148810209-148810296 [+]
intergenic

View flanking features
Clustered miRNAs
< 10kb from hsa-mir-145
hsa-mir-143 5: 148808481-148808586 [+]
hsa-mir-145 5: 148810209-148810296 [+]
Database links
Gene family

MIPF0000079; mir-145

Mature sequence MIMAT0000437

Accession MIMAT0000437
ID hsa-miR-145
Sequence

16 -  

guccaguuuucccaggaaucccu

 - 38

Get sequence
Evidence experimental; cloned [2-4]
Predicted targets

Minor miR* sequence MIMAT0004601

Accession MIMAT0004601
ID hsa-miR-145*
Sequence

54 -  

ggauuccuggaaauacuguucu

 - 75

Get sequence
Evidence experimental; cloned [4]
Predicted targets

References

1
"Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
"Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
"Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
"A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).