Stem-loop sequence hsa-mir-145

AccessionMI0000461 (change log)
Symbol HGNC:MIR145
DescriptionHomo sapiens miR-145 stem-loop
Gene family MIPF0000079; mir-145
Literature search

668 open access papers mention hsa-mir-145
(4188 sentences)

Stem-loop
   c   u  u     c  uc    u  c            uagau 
5'  acc ug ccuca gg  cagu uu ccaggaaucccu     g
    ||| || ||||| ||  |||| || ||||||||||||     c
3'  ugg ac ggagu uc  guca aa gguccuuagggg     u
   u   u  u     -  uu    u  a            uagaa 
Get sequence
Deep sequencing
9725376 reads, 2.99e+04 reads per million, 150 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-145 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 149430646-149430733 [+]
sense
OTTHUMT00000373771 ; HMGXB3-001; intron 19
OTTHUMT00000373770 ; HMGXB3-002; intron 20
ENST00000502717 ; HMGXB3-001; intron 19
ENST00000503427 ; HMGXB3-002; intron 20
Clustered miRNAs
< 10kb from hsa-mir-145
hsa-mir-143chr5: 149428918-149429023 [+]
hsa-mir-145chr5: 149430646-149430733 [+]
Database links

Mature sequence hsa-miR-145-5p

Accession MIMAT0000437
Previous IDshsa-miR-145
Sequence

16 - 

guccaguuuucccaggaaucccu

 - 38

Get sequence
Deep sequencing9052433 reads, 150 experiments
Evidence experimental; cloned [2-4]
Database links
Predicted targets

Mature sequence hsa-miR-145-3p

Accession MIMAT0004601
Previous IDshsa-miR-145*
Sequence

54 - 

ggauuccuggaaauacuguucu

 - 75

Get sequence
Deep sequencing672717 reads, 135 experiments
Evidence experimental; cloned [4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15978578 "Identification of human fetal liver miRNAs by a novel method" Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X FEBS Lett. 579:3849-3854(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).