Stem-loop sequence hsa-mir-144

AccessionMI0000460
Symbol HGNC:MIR144
DescriptionHomo sapiens miR-144 stem-loop
Gene family MIPF0000093; mir-144
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-144. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-144 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. In humans, miR-144 has been characterised as a "common miRNA signature" of a number of different tumours. GATA4 is thought to activate transcription of the miR-144 microRNA precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -u   -    u      g        a         -a    gc 
5'   ggg gccc ggcugg auaucauc uauacugua  guuu  g
     ||| |||| |||||| |||||||| |||||||||  ||||   
3'   ccc cggg cugauc uguaguag auaugacau  caga  a
   cc   a    c      a        -         ca    gu 
Get sequence
Deep sequencing
86806 reads, 3.44e+03 reads per million, 54 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 28861533-28861618 [-]
antisense
OTTHUMT00000443628 ; ALOX12P1-001; intron 3
ENST00000579299 ; ALOX12P1-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-144
hsa-mir-4732chr17: 28861655-28861730 [-]
hsa-mir-144chr17: 28861533-28861618 [-]
hsa-mir-451bchr17: 28861371-28861438 [+]
hsa-mir-451achr17: 28861369-28861440 [-]
Database links

Mature sequence hsa-miR-144-5p

Accession MIMAT0004600
Previous IDshsa-miR-144*
Sequence

15 - 

ggauaucaucauauacuguaag

 - 36

Get sequence
Deep sequencing152 reads, 22 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-144-3p

Accession MIMAT0000436
Previous IDshsa-miR-144
Sequence

52 - 

uacaguauagaugauguacu

 - 71

Get sequence
Deep sequencing695 reads, 41 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).