Stem-loop sequence hsa-mir-144

AccessionMI0000460 (change log)
Symbol HGNC:MIR144
DescriptionHomo sapiens miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

164 open access papers mention hsa-mir-144
(953 sentences)

Stem-loop
   -u   -    u      g        a         -a    gc 
5'   ggg gccc ggcugg auaucauc uauacugua  guuu  g
     ||| |||| |||||| |||||||| |||||||||  ||||   
3'   ccc cggg cugauc uguaguag auaugacau  caga  a
   cc   a    c      a        -         ca    gu 
Get sequence
Deep sequencing
150203 reads, 641 reads per million, 140 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 28861533-28861618 [-]
antisense
OTTHUMT00000443628 ; ALOX12P1-001; intron 3
ENST00000579299 ; ALOX12P1-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-144
hsa-mir-4732chr17: 28861655-28861730 [-]
hsa-mir-144chr17: 28861533-28861618 [-]
hsa-mir-451bchr17: 28861371-28861438 [+]
hsa-mir-451achr17: 28861369-28861440 [-]
Database links

Mature sequence hsa-miR-144-5p

Accession MIMAT0004600
Previous IDshsa-miR-144*
Sequence

15 - 

ggauaucaucauauacuguaag

 - 36

Get sequence
Deep sequencing102680 reads, 115 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-144-3p

Accession MIMAT0000436
Previous IDshsa-miR-144
Sequence

52 - 

uacaguauagaugauguacu

 - 71

Get sequence
Deep sequencing47514 reads, 133 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).