Stem-loop sequence hsa-mir-144

Accession

MI0000460

Symbol

HGNC:MIR144

Description

Homo sapiens miR-144 stem-loop

Gene family

MIPF0000093; mir-144

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-144. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

miR-144 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. In humans, miR-144 has been characterised as a "common miRNA signature" of a number of different tumours. GATA4 is thought to activate transcription of the miR-144 microRNA precursor.

Stem-loop

-u   -    u      g        a         -a    gc 
  ggg gccc ggcugg auaucauc uauacugua  guuu  g
  ||| |||| |||||| |||||||| |||||||||  ||||   
  ccc cggg cugauc uguaguag auaugacau  caga  a
cc   a    c      a        -         ca    gu 

Deep sequencing

824 reads, 32 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. The expression of this miRNA has not been verified in human. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chr17: 27188551-27188636 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000446722 ; RP11-20B24.2-001; exon 1

  ENST00000582320 ; MIR451B-001; exon 1

Clustered miRNAs

< 10kb from hsa-mir-144

• hsa-mir-4732: chr17: 27188673-27188748 [-]
• hsa-mir-144: chr17: 27188551-27188636 [-]
• hsa-mir-451b: chr17: 27188389-27188456 [+]
• hsa-mir-451a: chr17: 27188387-27188458 [-]

Database links

• ENTREZGENE: 406936;MIR144
• HGNC: 31531;MIR144

Mature sequence hsa-miR-144-5p

• Accession: MIMAT0004600
• Previous IDs: hsa-miR-144*
• Sequence: 15 - ggauaucaucauauacuguaag - 36
• Deep sequencing: 2 reads, 2 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-144-5p
  • MICRORNA.ORG:hsa-miR-144-5p
  • MIRDB:hsa-miR-144-5p
  • RNA22-HSA:hsa-miR-144-5p
  • TARGETMINER:hsa-miR-144-5p
  • PICTAR-VERT:hsa-miR-144

Mature sequence hsa-miR-144-3p

• Accession: MIMAT0000436
• Previous IDs: hsa-miR-144
• Sequence: 52 - uacaguauagaugauguacu - 71
• Deep sequencing: 821 reads, 30 experiments
• Evidence: experimental; cloned [2]
• Validated targets:
  • TARBASE:hsa-miR-144-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-144-3p
  • MICRORNA.ORG:hsa-miR-144-3p
  • MIRDB:hsa-miR-144-3p
  • RNA22-HSA:hsa-miR-144-3p
  • TARGETMINER:hsa-miR-144-3p
  • TARGETSCAN-VERT:hsa-miR-144
  • PICTAR-VERT:hsa-miR-144

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).