Stem-loop sequence MI0000459

Accession

MI0000459

ID

hsa-mir-143

Symbol

HGNC:MIR143

Description

Homo sapiens miR-143 stem-loop

Stem-loop

-gc    c  ccug    c ag      g         g      u  -  ag 
   gcag gc    ucuc c  ccugag ugcagugcu caucuc gg uc  u
   |||| ||    |||| |  |||||| ||||||||| |||||| || ||   
   cguc ug    agag g  ggacuc augucacga guagag cu ag  u
cga    u  uuga    a aa      g         a      u  g  gg 

Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-143 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. miR-143 cloned in [3] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context

• Coordinates (GRCh37): 5: 148808481-148808586 [+]
• Overlapping transcripts:

  intergenic

View flanking features

Clustered miRNAs

< 10kb from hsa-mir-143

• hsa-mir-143: 5: 148808481-148808586 [+]
• hsa-mir-145: 5: 148810209-148810296 [+]

Database links

• HGNC: 31530;MIR143
• ENTREZGENE: 406935;MIR143

Gene family

MIPF0000094; mir-143

Mature sequence MIMAT0000435

• Accession: MIMAT0000435
• ID: hsa-miR-143
• Sequence: 61 - ugagaugaagcacuguagcuc - 81
• Evidence: experimental; cloned [2-3], Solexa [4]
• Predicted targets:
  • MICROCOSM:hsa-miR-143
  • MICRORNA.ORG:hsa-miR-143
  • TARGETSCAN:hsa-miR-143
  • PICTAR-VERT:hsa-miR-143

Minor miR* sequence MIMAT0004599

• Accession: MIMAT0004599
• ID: hsa-miR-143*
• Sequence: 27 - ggugcagugcugcaucucuggu - 48
• Evidence: experimental; cloned [3]
• Predicted targets:
  • MICROCOSM:hsa-miR-143*
  • TARGETSCAN:hsa-miR-143*

References

1. "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha" Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V BMC Genomics. 11 Suppl 1:S6(2010).