Stem-loop sequence hsa-mir-143

AccessionMI0000459 (change log)
Symbol HGNC:MIR143
DescriptionHomo sapiens miR-143 stem-loop
Gene family MIPF0000094; mir-143
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-143. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-143 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms. mir–143 is highly conserved in vertebrates. mir-143 is thought be involved in cardiac morphogenesis but has also been implicated in cancer.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   -gc    c  ccug    c ag      g         g      u  -  ag 
5'    gcag gc    ucuc c  ccugag ugcagugcu caucuc gg uc  u
      |||| ||    |||| |  |||||| ||||||||| |||||| || ||   
3'    cguc ug    agag g  ggacuc augucacga guagag cu ag  u
   cga    u  uuga    a aa      g         a      u  g  gg 
Get sequence
Deep sequencing
2677600 reads, 4.52e+04 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-143 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. miR-143 cloned in [3] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 149428918-149429023 [+]
sense
OTTHUMT00000373774 ; HMGXB3-005; intron 2
OTTHUMT00000373771 ; HMGXB3-001; intron 18
OTTHUMT00000373770 ; HMGXB3-002; intron 19
ENST00000510472 ; HMGXB3-005; intron 2
ENST00000502717 ; HMGXB3-001; intron 18
ENST00000503427 ; HMGXB3-002; intron 19
Clustered miRNAs
< 10kb from hsa-mir-143
hsa-mir-143chr5: 149428918-149429023 [+]
hsa-mir-145chr5: 149430646-149430733 [+]
Database links

Mature sequence hsa-miR-143-5p

Accession MIMAT0004599
Previous IDshsa-miR-143*
Sequence

27 - 

ggugcagugcugcaucucuggu

 - 48

Get sequence
Deep sequencing2018 reads, 45 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-143-3p

Accession MIMAT0000435
Previous IDshsa-miR-143
Sequence

61 - 

ugagaugaagcacuguagcuc

 - 81

Get sequence
Deep sequencing2674727 reads, 76 experiments
Evidence experimental; cloned [2-3], Illumina [4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4