Stem-loop sequence hsa-mir-142

Accession

MI0000458

Symbol

HGNC:MIR142

Description

Homo sapiens miR-142 stem-loop

Gene family

MIPF0000084; mir-142

Stem-loop

g        g   c           a         uaa ag a 
 acagugca uca ccauaaaguag aagcacuac   c  c c
 |||||||| ||| ||||||||||| |||||||||   |  |  
 ugucaugu agu gguauuucauc uuugugaug   g  g u
g        g   a           c         -ug ga g 

Deep sequencing

3636 reads, 46 experiments

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Michael et al. verified the expression of a sequence from the 3' arm of this stem-loop (named miR-142-3p here) [2], and both miR-142-5p (from the 5' arm) and miR-142-3p ware later detected in human HL-60 leukemia cells [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCh37.p5): chr17: 56408593-56408679 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000443998 ; RP5-1171I10.5-001; exon 1

  ENST00000579003 ; hsa-mir-142.1-001; exon 1

  antisense

  OTTHUMT00000443988 ; RP5-1171I10.4-002; intron 1

  OTTHUMT00000443989 ; RP5-1171I10.4-003; intron 1

  OTTHUMT00000443990 ; RP5-1171I10.4-009; intron 1

  OTTHUMT00000443987 ; RP5-1171I10.4-001; intron 2

  ENST00000580515 ; RP5-1171I10.4-002; intron 1

  ENST00000578334 ; RP5-1171I10.4-003; intron 1

  ENST00000580633 ; RP5-1171I10.4-009; intron 1

  ENST00000579527 ; RP5-1171I10.4-001; intron 2

Clustered miRNAs

< 10kb from hsa-mir-142

• hsa-mir-4736: chr17: 56413337-56413383 [-]
• hsa-mir-142: chr17: 56408593-56408679 [-]

Database links

• ENTREZGENE: 406934;MIR142
• HGNC: 31529;MIR142

Mature sequence hsa-miR-142-5p

• Accession: MIMAT0000433
• Sequence: 16 - cauaaaguagaaagcacuacu - 36
• Deep sequencing: 700 reads, 20 experiments
• Evidence: experimental; cloned [3-4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-142-5p
  • MICRORNA.ORG:hsa-miR-142-5p
  • MIRDB:hsa-miR-142-5p
  • RNA22-HSA:hsa-miR-142-5p
  • TARGETMINER:hsa-miR-142-5p
  • TARGETSCAN-VERT:hsa-miR-142-5p
  • PICTAR-VERT:hsa-miR-142-3p
  • PICTAR-VERT:hsa-miR-142-5p

Mature sequence hsa-miR-142-3p

• Accession: MIMAT0000434
• Sequence: 52 - uguaguguuuccuacuuuaugga - 74
• Deep sequencing: 2935 reads, 29 experiments
• Evidence: experimental; cloned [2-4]
• Validated targets:
  • TARBASE:hsa-miR-142-3p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-142-3p
  • MICRORNA.ORG:hsa-miR-142-3p
  • MIRDB:hsa-miR-142-3p
  • RNA22-HSA:hsa-miR-142-3p
  • TARGETMINER:hsa-miR-142-3p
  • TARGETSCAN-VERT:hsa-miR-142-3p
  • PICTAR-VERT:hsa-miR-142-3p
  • PICTAR-VERT:hsa-miR-142-5p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3. PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).