Stem-loop sequence hsa-mir-142

AccessionMI0000458
Symbol HGNC:MIR142
DescriptionHomo sapiens miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   g        g   c           a         uaa ag a 
5'  acagugca uca ccauaaaguag aagcacuac   c  c c
    |||||||| ||| ||||||||||| |||||||||   |  |  
3'  ugucaugu agu gguauuucauc uuugugaug   g  g u
   g        g   a           c         -ug ga g 
Get sequence
Deep sequencing
62641 reads, 1.3e+04 reads per million, 64 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Michael et al. verified the expression of a sequence from the 3' arm of this stem-loop (named miR-142-3p here) [2], and both miR-142-5p (from the 5' arm) and miR-142-3p ware later detected in human HL-60 leukemia cells [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 58331232-58331318 [-]
sense
OTTHUMT00000449450 ; USP32-004; intron 2
OTTHUMT00000449458 ; USP32-007; intron 2
OTTHUMT00000449235 ; USP32-001; intron 10
OTTHUMT00000449454 ; USP32-002; intron 10
OTTHUMT00000449459 ; USP32-003; intron 10
ENST00000592339 ; USP32-004; intron 2
ENST00000589335 ; USP32-007; intron 2
ENST00000300896 ; USP32-001; intron 10
ENST00000590133 ; USP32-002; intron 10
ENST00000393003 ; USP32-003; intron 10
Clustered miRNAs
< 10kb from hsa-mir-142
hsa-mir-4736chr17: 58335976-58336022 [-]
hsa-mir-142chr17: 58331232-58331318 [-]
Database links

Mature sequence hsa-miR-142-5p

Accession MIMAT0000433
Sequence

16 - 

cauaaaguagaaagcacuacu

 - 36

Get sequence
Deep sequencing12187 reads, 56 experiments
Evidence experimental; cloned [3-4]
Predicted targets

Mature sequence hsa-miR-142-3p

Accession MIMAT0000434
Sequence

52 - 

uguaguguuuccuacuuuaugga

 - 74

Get sequence
Deep sequencing5347 reads, 55 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:15325244 "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells" Kasashima K, Nakamura Y, Kozu T Biochem Biophys Res Commun. 322:403-410(2004).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).