Stem-loop sequence hsa-mir-141

Accession MI0000457
Symbol HGNC:MIR141
Description Homo sapiens miR-141 stem-loop
Gene family MIPF0000019; mir-8
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c    g    u   -u       --    u        -   ugg  ua 
 ggcc gccc ggg  ccaucuu  ccag acaguguu gga   uc  a
 |||| |||| |||  |||||||  |||| |||||||| |||   ||  u
 uugg uggg ccc  gguagaa  gguc ugucacaa ccu   ag  u
c    g    -   uc       au    -        u   cga  ug 
Get sequence
Deep sequencing
364 reads, 30 experiments
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-141 in human [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr12: 7073260-7073354 [+]
sense
OTTHUMT00000402989 ; U47924.27-001; intron 1
OTTHUMT00000402989 ; U47924.27-001; intron 1
OTTHUMT00000402989 ; U47924.27-001; intron 1
ENST00000537269 ; U47924.27-001; intron 1
ENST00000537269 ; U47924.27-001; intron 1
ENST00000537269 ; U47924.27-001; intron 1
Clustered miRNAs
< 10kb from hsa-mir-141
hsa-mir-200c chr12: 7072862-7072929 [+]
hsa-mir-141 chr12: 7073260-7073354 [+]
Database links

Mature sequence hsa-miR-141-5p

Accession MIMAT0004598
Previous IDs hsa-miR-141*
Sequence

17 - 

caucuuccaguacaguguugga

 - 38

Get sequence
Deep sequencing 4 reads, 2 experiments
Evidence experimental; cloned [3]
Predicted targets

Mature sequence hsa-miR-141-3p

Accession MIMAT0000432
Previous IDs hsa-miR-141
Sequence

59 - 

uaacacugucugguaaagaugg

 - 80

Get sequence
Deep sequencing 353 reads, 28 experiments
Evidence experimental; cloned [2-4]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).