Stem-loop sequence hsa-mir-141

AccessionMI0000457 (change log)
Symbol HGNC:MIR141
DescriptionHomo sapiens miR-141 stem-loop
Gene family MIPF0000019; mir-8
Literature search

359 open access papers mention hsa-mir-141
(1896 sentences)

Stem-loop
   c    g    u   -u       --    u        -   ugg  ua 
5'  ggcc gccc ggg  ccaucuu  ccag acaguguu gga   uc  a
    |||| |||| |||  |||||||  |||| |||||||| |||   ||  u
3'  uugg uggg ccc  gguagaa  gguc ugucacaa ccu   ag  u
   c    g    -   uc       au    -        u   cga  ug 
Get sequence
Deep sequencing
746410 reads, 1.7e+03 reads per million, 154 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-141 in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 6964097-6964191 [+]
sense
OTTHUMT00000402982 ; USP5-001; intron 1
OTTHUMT00000402983 ; USP5-002; intron 1
OTTHUMT00000402984 ; USP5-003; intron 1
ENST00000229268 ; USP5-001; intron 1
ENST00000389231 ; USP5-002; intron 1
ENST00000542087 ; USP5-003; intron 1
Clustered miRNAs
< 10kb from hsa-mir-141
hsa-mir-200cchr12: 6963699-6963766 [+]
hsa-mir-141chr12: 6964097-6964191 [+]
Database links

Mature sequence hsa-miR-141-5p

Accession MIMAT0004598
Previous IDshsa-miR-141*
Sequence

17 - 

caucuuccaguacaguguugga

 - 38

Get sequence
Deep sequencing5063 reads, 112 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

Mature sequence hsa-miR-141-3p

Accession MIMAT0000432
Previous IDshsa-miR-141
Sequence

59 - 

uaacacugucugguaaagaugg

 - 80

Get sequence
Deep sequencing741123 reads, 153 experiments
Evidence experimental; cloned [2-4]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:14573789 "Reduced accumulation of specific microRNAs in colorectal neoplasia" Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ Mol Cancer Res. 1:882-891(2003).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).