Stem-loop sequence hsa-mir-140

Accession MI0000456
Symbol HGNC:MIR140
Description Homo sapiens miR-140 stem-loop
Gene family MIPF0000085; mir-140
Stem-loop 
u       ucucu        -  a             a       uu   uc 
 gugucuc     guguccug cc gugguuuuacccu ugguagg  acg  a
 |||||||     |||||||| || ||||||||||||| |||||||  |||   
 cacgggg     cauaggac gg caccaagauggga accaucu  ugu  u
c       ----c        a  -             c       --   cg
Get sequence
Deep sequencing
352280 reads, 49 experiments
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr16: 69966984-69967083 [+]
sense
OTTHUMT00000434491 ; WWP2-017; intron 3
OTTHUMT00000434491 ; WWP2-017; intron 3
OTTHUMT00000434489 ; WWP2-015; intron 6
OTTHUMT00000434489 ; WWP2-015; intron 6
OTTHUMT00000434488 ; WWP2-014; intron 7
OTTHUMT00000434488 ; WWP2-014; intron 7
OTTHUMT00000434486 ; WWP2-011; intron 9
OTTHUMT00000434486 ; WWP2-011; intron 9
OTTHUMT00000434482 ; WWP2-002; intron 14
OTTHUMT00000434482 ; WWP2-002; intron 14
OTTHUMT00000268954 ; WWP2-001; intron 16
OTTHUMT00000268954 ; WWP2-001; intron 16
OTTHUMT00000268954 ; WWP2-001; intron 16
ENST00000568818 ; WWP2-017; intron 3
ENST00000568818 ; WWP2-017; intron 3
ENST00000568684 ; WWP2-015; intron 6
ENST00000568684 ; WWP2-015; intron 6
ENST00000566463 ; WWP2-014; intron 7
ENST00000566463 ; WWP2-014; intron 7
ENST00000569297 ; WWP2-011; intron 9
ENST00000569297 ; WWP2-011; intron 9
ENST00000542271 ; WWP2-203; intron 13
ENST00000542271 ; WWP2-203; intron 13
ENST00000542271 ; WWP2-203; intron 13
ENST00000544162 ; WWP2-204; intron 14
ENST00000544162 ; WWP2-002; intron 14
ENST00000544162 ; WWP2-002; intron 14
ENST00000356003 ; WWP2-201; intron 15
ENST00000356003 ; WWP2-201; intron 15
ENST00000356003 ; WWP2-201; intron 15
ENST00000359154 ; WWP2-001; intron 16
ENST00000448661 ; WWP2-202; intron 16
ENST00000545099 ; WWP2-205; intron 16
ENST00000359154 ; WWP2-001; intron 16
ENST00000448661 ; WWP2-202; intron 16
ENST00000545099 ; WWP2-204; intron 16
ENST00000359154 ; WWP2-001; intron 16
ENST00000448661 ; WWP2-202; intron 16
Database links

Mature sequence hsa-miR-140-5p

Accession MIMAT0000431
Previous IDs hsa-miR-140
Sequence

23 -  

cagugguuuuacccuaugguag

 - 44

Get sequence
Deep sequencing 171 reads, 27 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-140-3p

Accession MIMAT0004597
Sequence

62 -  

uaccacaggguagaaccacgg

 - 82

Get sequence
Deep sequencing 352101 reads, 39 experiments
Evidence experimental; cloned [3-4]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15800047 "Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells" Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR Proc Natl Acad Sci U S A. 102:5570-5575(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).