Stem-loop sequence hsa-mir-138-2

AccessionMI0000455
Symbol HGNC:MIR138-2
DescriptionHomo sapiens miR-138-2 stem-loop
Gene family MIPF0000075; mir-138
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-138. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-138 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-138 precursor is the microRNA mir-138. miR-138 has been used as an example of the post-transcriptional regulation of miRNA, due to the finding that while the precursor is expressed ubiquitously, the mature product is found only in specific cell types.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   c u   u  ag             uca     -ac   c  cg 
5'  g ugc gc  cugguguugugaa   ggccg   gag ag  c
    | ||| ||  |||||||||||||   |||||   ||| ||   
3'  c acg ug  gaccacagcacuu   ucggc   uuc uc  a
   a u   u  -g             -ua     cca   -  cu 
Get sequence
Deep sequencing
6376 reads, 859 reads per million, 49 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr16: 56858518-56858601 [+]
sense
OTTHUMT00000432493 ; NUP93-023; intron 4
OTTHUMT00000432380 ; NUP93-003; intron 6
OTTHUMT00000432397 ; NUP93-018; intron 6
OTTHUMT00000432381 ; NUP93-004; intron 6
OTTHUMT00000257058 ; NUP93-001; intron 8
OTTHUMT00000432379 ; NUP93-002; intron 8
ENST00000563858 ; NUP93-023; intron 4
ENST00000564887 ; NUP93-003; intron 6
ENST00000567641 ; NUP93-018; intron 6
ENST00000542526 ; NUP93-004; intron 6
ENST00000308159 ; NUP93-001; intron 8
ENST00000569842 ; NUP93-002; intron 8
Database links

Mature sequence hsa-miR-138-5p

Accession MIMAT0000430
Previous IDshsa-miR-138
Sequence

10 - 

agcugguguugugaaucaggccg

 - 32

Get sequence
Deep sequencing8879 reads, 47 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-138-2-3p

Accession MIMAT0004596
Previous IDshsa-miR-138-2*
Sequence

57 - 

gcuauuucacgacaccaggguu

 - 78

Get sequence
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).