Stem-loop sequence hsa-mir-138-2

AccessionMI0000455 (change log)
Symbol HGNC:MIR138-2
DescriptionHomo sapiens miR-138-2 stem-loop
Gene family MIPF0000075; mir-138
Literature search

226 open access papers mention hsa-mir-138-2
(1596 sentences)

Stem-loop
   c u   u  ag             uca     -ac   c  cg 
5'  g ugc gc  cugguguugugaa   ggccg   gag ag  c
    | ||| ||  |||||||||||||   |||||   ||| ||   
3'  c acg ug  gaccacagcacuu   ucggc   uuc uc  a
   a u   u  -g             -ua     cca   -  cu 
Get sequence
Deep sequencing
88080 reads, 160 reads per million, 131 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 56858518-56858601 [+]
sense
OTTHUMT00000432493 ; NUP93-023; intron 4
OTTHUMT00000432380 ; NUP93-003; intron 6
OTTHUMT00000432397 ; NUP93-018; intron 6
OTTHUMT00000432381 ; NUP93-004; intron 6
OTTHUMT00000257058 ; NUP93-001; intron 8
OTTHUMT00000432379 ; NUP93-002; intron 8
ENST00000563858 ; NUP93-023; intron 4
ENST00000564887 ; NUP93-003; intron 6
ENST00000567641 ; NUP93-018; intron 6
ENST00000542526 ; NUP93-004; intron 6
ENST00000308159 ; NUP93-001; intron 8
ENST00000569842 ; NUP93-002; intron 8
Database links

Mature sequence hsa-miR-138-5p

Accession MIMAT0000430
Previous IDshsa-miR-138
Sequence

10 - 

agcugguguugugaaucaggccg

 - 32

Get sequence
Deep sequencing176706 reads, 139 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-138-2-3p

Accession MIMAT0004596
Previous IDshsa-miR-138-2*
Sequence

57 - 

gcuauuucacgacaccaggguu

 - 78

Get sequence
Deep sequencing182 reads, 33 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).