Stem-loop sequence hsa-mir-137

AccessionMI0000454
Symbol HGNC:MIR137
DescriptionHomo sapiens miR-137 stem-loop
Gene family MIPF0000106; mir-137
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-137. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-137 (or microRNA-137) is a short non-coding RNA molecule that functions to regulate the expression levels of other genes by various mechanisms. miR-137 is located on human chromosome 1p22 and has been implicated to act as a tumor suppressor in several cancer types including colorectal cancer, squamous cell carcinoma and melanoma via cell cycle control. Recent genome-wide association studies (GWAS) have provided evidence to suggest that single nucleotide polymorphisms in the vicinity of the MIR137 gene are statistically associated with schizophrenia and other psychiatric disorders. miR-137 is shown to regulate neural stem cell proliferation and differentiation in mouse embryonic stem cells, and neuronal maturation, including regulation of dendrite length, branch points, end points, and spine density in mouse adult hippocampal neuroprogenitor-derived and mouse fetal hippocampus neurons. Decreased spine density has also been observed in the dorsolateral cortex of patients with schizophrenia. miR-137 belongs to the miR-137 clan (a clan is group of two or more RNA families that have arisen from a single evolutionary origin, as derived from their related structure and function). The miR-137 clan contains two members: miR-137 and miR-234; the total number of RNA domains in the clan is 112.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   g u  u   --           ug   g           ug a     -  g 
5'  g cc cug  acucucuucgg  acg guauucuuggg  g uaaua cg a
    | || |||  |||||||||||  ||| |||||||||||  | ||||| || u
3'  c gg gac  ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   a -  c   ca           ga   g           gu -     u  a 
Get sequence
Deep sequencing
722 reads, 120 reads per million, 19 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr1: 98046070-98046171 [-]
sense
OTTHUMT00000095698 ; DPYD-001; intron 10
ENST00000370192 ; DPYD-001; intron 10
Clustered miRNAs
< 10kb from hsa-mir-137
hsa-mir-137chr1: 98046070-98046171 [-]
hsa-mir-2682chr1: 98045242-98045351 [-]
Database links

Mature sequence hsa-miR-137

Accession MIMAT0000429
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Deep sequencing54 reads, 13 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).