Stem-loop sequence hsa-mir-137

AccessionMI0000454 (change log)
Symbol HGNC:MIR137
DescriptionHomo sapiens miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

199 open access papers mention hsa-mir-137
(1743 sentences)

Stem-loop
   g u  u   --           ug   g           ug a     -  g 
5'  g cc cug  acucucuucgg  acg guauucuuggg  g uaaua cg a
    | || |||  |||||||||||  ||| |||||||||||  | ||||| || u
3'  c gg gac  ugagaggagcu  ugc cauaagaauuc  u auugu gc u
   a -  c   ca           ga   g           gu -     u  a 
Get sequence
Deep sequencing
117259 reads, 246 reads per million, 104 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 98046070-98046171 [-]
sense
OTTHUMT00000095698 ; DPYD-001; intron 10
ENST00000370192 ; DPYD-001; intron 10
Clustered miRNAs
< 10kb from hsa-mir-137
hsa-mir-137chr1: 98046070-98046171 [-]
hsa-mir-2682chr1: 98045242-98045351 [-]
Database links

Mature sequence hsa-miR-137-5p

Accession MIMAT0037310
Sequence

23 - 

acggguauucuuggguggauaau

 - 45

Get sequence
Deep sequencing3344 reads, 16 experiments
Evidence not experimental

Mature sequence hsa-miR-137-3p

Accession MIMAT0000429
Sequence

59 - 

uuauugcuuaagaauacgcguag

 - 81

Get sequence
Deep sequencing112621 reads, 101 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).