Stem-loop sequence hsa-mir-135a-1

Accession MI0000452
Previous IDs hsa-mir-135-1
Symbol HGNC:MIR135A1
Description Homo sapiens miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a g         u u          uu            uucua 
 g ccucgcugu c cuauggcuuu  auuccuauguga     c
 | ||||||||| | ||||||||||  ||||||||||||     u
 c ggggcggca g ggugccgagg  uagggauauacu     g
a a         c c          -u            cacuc 
Get sequence
Deep sequencing
405 reads, 21 experiments
Comments

miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr3: 52328235-52328324 [-]
sense
OTTHUMT00000350824 ; RP11-168J18.4-001; intron 1
OTTHUMT00000350826 ; RP11-168J18.4-003; intron 1
OTTHUMT00000350824 ; RP11-168J18.4-001; intron 1
OTTHUMT00000350826 ; RP11-168J18.4-003; intron 1
OTTHUMT00000350824 ; RP11-168J18.4-001; intron 1
OTTHUMT00000350826 ; RP11-168J18.4-003; intron 1
ENST00000493616 ; GLYCTK-AS1-001; intron 1
ENST00000467187 ; GLYCTK-AS1-003; intron 1
ENST00000493616 ; GLYCTK-AS1-001; intron 1
ENST00000467187 ; GLYCTK-AS1-003; intron 1
ENST00000493616 ; GLYCTK-AS1-001; intron 1
ENST00000467187 ; GLYCTK-AS1-003; intron 1
antisense
ENST00000411757 ; GLYCTK-203; exon 3
ENST00000411757 ; GLYCTK-203; exon 3
ENST00000354773 ; GLYCTK-202; exon 4
ENST00000354773 ; GLYCTK-202; exon 4
ENST00000354773 ; GLYCTK-202; exon 4
Database links

Mature sequence hsa-miR-135a-5p

Accession MIMAT0000428
Previous IDs hsa-miR-135a
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Deep sequencing 805 reads, 22 experiments
Evidence experimental; cloned [2-3]
Validated targets
Predicted targets

Mature sequence hsa-miR-135a-3p

Accession MIMAT0004595
Previous IDs hsa-miR-135a*
Sequence

56 - 

uauagggauuggagccguggcg

 - 77

Get sequence
Deep sequencing 3 reads, 2 experiments
Evidence experimental; cloned [3]
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).