miRNA Entry for MI0000452

The text in this section is taken from the free, online encyclopedia, Wikipedia. Anyone can edit a Wikipedia page. We hope that experts on particular microRNA sequences will use the links to Wikipedia below to edit the annotation of individual microRNAs, to add information about function, evolution, discovery, and literature references, for example. Any changes that you make will be visible in Wikipedia immediately, and in miRBase within 24 hours.

Editing Wikipedia entries is straightforward. If you haven't edited a page before, you might like to take a look at the following Wikipedia help pages:

You can also create new pages at Wikipedia about microRNA families that do not currently have specific entries there. Please let us know if you do, so we can incorporate your annotation into miRBase, and create the appropriate links from miRBase entries to the relevant Wikipedia pages.

Please note, we're not responsible for the content of Wikipedia pages.

You can read more about miRBase, Wikipedia and community annotation on this blog post.

Please email us for help or with comments about this community annotation initiative.

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

mir-135 microRNA precursor family

Predicted secondary structure and sequence conservation of mir-135
Identifiers
Symbol	mir-135
Rfam	RF00246
miRBase	MI0000452
miRBase family	MIPF0000028
Other data
RNA type	Gene; miRNA
Domain(s)	Eukaryota
GO	0035195 0035068
SO	0001244

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat.^[1]^[2] miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

[edit] Targets of miR-135

Nagel et al.. showed that miR-135a and b target the 3' untranslated region of the APC gene.^[3]

[edit] References

^ Lagos-Quintana, M; Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T (2002). "Identification of tissue-specific microRNAs from mouse". Curr Biol 12 (9): 735–739. doi:10.1016/S0960-9822(02)00809-6. PMID 12007417.
^ Kim, J; Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G (2004). "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons". Proc Natl Acad Sci USA 101 (1): 360–365. Bibcode 2003PNAS..101..360K. doi:10.1073/pnas.2333854100. PMC 314190. PMID 14691248. //www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pmcentrez&artid=314190.
^ Nagel R, le Sage C, Diosdado B, et al (July 2008). "Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer". Cancer Research 68 (14): 5795–802. doi:10.1158/0008-5472.CAN-08-0951. PMID 18632633.

[edit] External links

v t e miRNA precursor families

1-100	1 · 2 · 6 · 7 · 8/141/200 · 9/79 · 10 · 15 · 16 · 17 · 19 · 21 · 22 · 24 · 26 · 29 · 30 · 31 · 33 · 34 · 46/47/281 · 92 · 96

101-200	101 · 103/107 · 122 · 124 · 126 · 127 · 129 · 130 · 132 · 133 · 134 · 135 · 137 · 138 · 143 · 144 · 145 · 146 · 148/152 · 150 · 155 · 156 · 160 · 166 · 172 · 181 · 184 · 191 · 192/215 · 194 · 196 · 199 · 200

201+	203 · 205 · 208 · 210 · 214 · 218 · 219 · 221 · 223 · 224 · 296 · 338 · 395 · 399 · 433 · 451

Other	BART1 · BART2 · BHRF1-1 · BHRF1-2 · BHRF1-3 · Let-7 · Lin-4 · Lsy-6

This molecular or cell biology article is a stub. You can help Wikipedia by expanding it.

Mature sequence hsa-miR-135a-5p
Accession	MIMAT0000428
Previous IDs	hsa-miR-135a
Sequence	17 - uauggcuuuuuauuccuauguga - 39 Get sequence
Deep sequencing	805 reads, 22 experiments
Evidence	experimental; cloned [2-3]
Validated targets	TARBASE:hsa-miR-135a-5p
Predicted targets	DIANA-MICROT:hsa-miR-135a-5p MICRORNA.ORG:hsa-miR-135a-5p MIRDB:hsa-miR-135a-5p RNA22-HSA:hsa-miR-135a-5p TARGETMINER:hsa-miR-135a-5p TARGETSCAN-VERT:hsa-miR-135a PICTAR-VERT:hsa-miR-135a

Mature sequence hsa-miR-135a-3p
Accession	MIMAT0004595
Previous IDs	hsa-miR-135a*
Sequence	56 - uauagggauuggagccguggcg - 77 Get sequence
Deep sequencing	3 reads, 2 experiments
Evidence	experimental; cloned [3]
Predicted targets	DIANA-MICROT:hsa-miR-135a-3p MICRORNA.ORG:hsa-miR-135a-3p MIRDB:hsa-miR-135a-3p RNA22-HSA:hsa-miR-135a-3p TARGETMINER:hsa-miR-135a-3p PICTAR-VERT:hsa-miR-135a

References
1	PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2	PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3	PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).

miRBase

Stem-loop sequence hsa-mir-135a-1

[edit] Targets of miR-135

[edit] References

[edit] External links

Mature sequence hsa-miR-135a-5p

Mature sequence hsa-miR-135a-3p

References