Stem-loop sequence hsa-mir-135a-1

AccessionMI0000452 (change log)
Previous IDshsa-mir-135-1
Symbol HGNC:MIR135A1
DescriptionHomo sapiens miR-135a-1 stem-loop
Gene family MIPF0000028; mir-135
Literature search

153 open access papers mention hsa-mir-135a-1
(506 sentences)

Stem-loop
   a g         u u          uu            uucua 
5'  g ccucgcugu c cuauggcuuu  auuccuauguga     c
    | ||||||||| | ||||||||||  ||||||||||||     u
3'  c ggggcggca g ggugccgagg  uagggauauacu     g
   a a         c c          -u            cacuc 
Get sequence
Deep sequencing
292449 reads, 590 reads per million, 151 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

miR-135a was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 52294219-52294308 [-]
sense
OTTHUMT00000350828 ; WDR82-002; intron 3
OTTHUMT00000317919 ; WDR82-001; intron 5
OTTHUMT00000350830 ; WDR82-004; intron 5
ENST00000487402 ; WDR82-002; intron 3
ENST00000296490 ; WDR82-001; intron 5
ENST00000469000 ; WDR82-004; intron 5
Database links

Mature sequence hsa-miR-135a-5p

Accession MIMAT0000428
Previous IDshsa-miR-135a
Sequence

17 - 

uauggcuuuuuauuccuauguga

 - 39

Get sequence
Deep sequencing549458 reads, 148 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-135a-3p

Accession MIMAT0004595
Previous IDshsa-miR-135a*
Sequence

56 - 

uauagggauuggagccguggcg

 - 77

Get sequence
Deep sequencing228 reads, 37 experiments
Evidence experimental; cloned [3]
Database links
Predicted targets

References

1
PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2
PMID:15183728 "Human embryonic stem cells express a unique set of microRNAs" Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS Dev Biol. 270:488-498(2004).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).